ID: 1174100650

View in Genome Browser
Species Human (GRCh38)
Location 20:48123963-48123985
Sequence CCGTGCTGCTATGTAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174100650_1174100658 22 Left 1174100650 20:48123963-48123985 CCCACAGTTACATAGCAGCACGG No data
Right 1174100658 20:48124008-48124030 CCACAACCCTCTGACTTCAATGG No data
1174100650_1174100659 25 Left 1174100650 20:48123963-48123985 CCCACAGTTACATAGCAGCACGG No data
Right 1174100659 20:48124011-48124033 CAACCCTCTGACTTCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174100650 Original CRISPR CCGTGCTGCTATGTAACTGT GGG (reversed) Intergenic
No off target data available for this crispr