ID: 1174103101

View in Genome Browser
Species Human (GRCh38)
Location 20:48142201-48142223
Sequence CTGTGTATGAGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174103101_1174103107 0 Left 1174103101 20:48142201-48142223 CCCTCCTCCCTCCTCATACACAG No data
Right 1174103107 20:48142224-48142246 TCTGACTGCAGCTTCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174103101 Original CRISPR CTGTGTATGAGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr