ID: 1174103767

View in Genome Browser
Species Human (GRCh38)
Location 20:48147565-48147587
Sequence GCTCTGGTCTGCGGGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174103767_1174103772 -3 Left 1174103767 20:48147565-48147587 CCAAGGACCCCGCAGACCAGAGC No data
Right 1174103772 20:48147585-48147607 AGCATGCCCTGAACTGATCAAGG No data
1174103767_1174103777 29 Left 1174103767 20:48147565-48147587 CCAAGGACCCCGCAGACCAGAGC No data
Right 1174103777 20:48147617-48147639 CTGTCCTCCACCTCATGACACGG No data
1174103767_1174103778 30 Left 1174103767 20:48147565-48147587 CCAAGGACCCCGCAGACCAGAGC No data
Right 1174103778 20:48147618-48147640 TGTCCTCCACCTCATGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174103767 Original CRISPR GCTCTGGTCTGCGGGGTCCT TGG (reversed) Intergenic