ID: 1174104781

View in Genome Browser
Species Human (GRCh38)
Location 20:48154472-48154494
Sequence CTGTGGGTATGAGGCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174104773_1174104781 1 Left 1174104773 20:48154448-48154470 CCCTAGCTCCTGGCCTCAGCATC No data
Right 1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG No data
1174104776_1174104781 -7 Left 1174104776 20:48154456-48154478 CCTGGCCTCAGCATCGCTGTGGG No data
Right 1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG No data
1174104774_1174104781 0 Left 1174104774 20:48154449-48154471 CCTAGCTCCTGGCCTCAGCATCG No data
Right 1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174104781 Original CRISPR CTGTGGGTATGAGGCTCAGA GGG Intergenic
No off target data available for this crispr