ID: 1174107604

View in Genome Browser
Species Human (GRCh38)
Location 20:48173848-48173870
Sequence CTGTCTGCCTTGGATAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174107604_1174107609 -3 Left 1174107604 20:48173848-48173870 CCCTGATTATCCAAGGCAGACAG No data
Right 1174107609 20:48173868-48173890 CAGAAGCATGTCCCTCTCTGGGG No data
1174107604_1174107607 -5 Left 1174107604 20:48173848-48173870 CCCTGATTATCCAAGGCAGACAG No data
Right 1174107607 20:48173866-48173888 GACAGAAGCATGTCCCTCTCTGG No data
1174107604_1174107608 -4 Left 1174107604 20:48173848-48173870 CCCTGATTATCCAAGGCAGACAG No data
Right 1174107608 20:48173867-48173889 ACAGAAGCATGTCCCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174107604 Original CRISPR CTGTCTGCCTTGGATAATCA GGG (reversed) Intergenic
No off target data available for this crispr