ID: 1174110536

View in Genome Browser
Species Human (GRCh38)
Location 20:48195006-48195028
Sequence CAGTGGGTATGAAGGACGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174110536_1174110544 9 Left 1174110536 20:48195006-48195028 CCCTCCGTCCTTCATACCCACTG No data
Right 1174110544 20:48195038-48195060 CACCTGTCACTCCCACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174110536 Original CRISPR CAGTGGGTATGAAGGACGGA GGG (reversed) Intergenic
No off target data available for this crispr