ID: 1174111485

View in Genome Browser
Species Human (GRCh38)
Location 20:48200917-48200939
Sequence CTCTGGGGCTCTCTGGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174111476_1174111485 -3 Left 1174111476 20:48200897-48200919 CCCTCCACCGACTGCCATCACTC No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111482_1174111485 -10 Left 1174111482 20:48200904-48200926 CCGACTGCCATCACTCTGGGGCT No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111475_1174111485 -2 Left 1174111475 20:48200896-48200918 CCCCTCCACCGACTGCCATCACT No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111470_1174111485 17 Left 1174111470 20:48200877-48200899 CCCCAGCCTGGAAGGGGACCCCC No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111472_1174111485 15 Left 1174111472 20:48200879-48200901 CCAGCCTGGAAGGGGACCCCCTC No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111474_1174111485 -1 Left 1174111474 20:48200895-48200917 CCCCCTCCACCGACTGCCATCAC No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111471_1174111485 16 Left 1174111471 20:48200878-48200900 CCCAGCCTGGAAGGGGACCCCCT No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111479_1174111485 -7 Left 1174111479 20:48200901-48200923 CCACCGACTGCCATCACTCTGGG No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111477_1174111485 -4 Left 1174111477 20:48200898-48200920 CCTCCACCGACTGCCATCACTCT No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data
1174111473_1174111485 11 Left 1174111473 20:48200883-48200905 CCTGGAAGGGGACCCCCTCCACC No data
Right 1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174111485 Original CRISPR CTCTGGGGCTCTCTGGCTTG AGG Intergenic
No off target data available for this crispr