ID: 1174112171

View in Genome Browser
Species Human (GRCh38)
Location 20:48204601-48204623
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174112171_1174112180 5 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112180 20:48204629-48204651 GTGCTGAGCAAGCTGGGGGCCGG No data
1174112171_1174112176 -2 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112176 20:48204622-48204644 GGCTTTCGTGCTGAGCAAGCTGG No data
1174112171_1174112184 24 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data
1174112171_1174112181 6 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112181 20:48204630-48204652 TGCTGAGCAAGCTGGGGGCCGGG No data
1174112171_1174112182 21 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112182 20:48204645-48204667 GGGCCGGGATGTCCCAGCACAGG No data
1174112171_1174112186 30 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112186 20:48204654-48204676 TGTCCCAGCACAGGAGGGACAGG No data
1174112171_1174112185 25 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112185 20:48204649-48204671 CGGGATGTCCCAGCACAGGAGGG No data
1174112171_1174112178 0 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112178 20:48204624-48204646 CTTTCGTGCTGAGCAAGCTGGGG No data
1174112171_1174112177 -1 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data
1174112171_1174112179 1 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112179 20:48204625-48204647 TTTCGTGCTGAGCAAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174112171 Original CRISPR CCAAAACCTCGCCTGGGCTT GGG (reversed) Intergenic