ID: 1174112174

View in Genome Browser
Species Human (GRCh38)
Location 20:48204607-48204629
Sequence CGAAAGCCAAAACCTCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174112174_1174112185 19 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112185 20:48204649-48204671 CGGGATGTCCCAGCACAGGAGGG No data
1174112174_1174112178 -6 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112178 20:48204624-48204646 CTTTCGTGCTGAGCAAGCTGGGG No data
1174112174_1174112181 0 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112181 20:48204630-48204652 TGCTGAGCAAGCTGGGGGCCGGG No data
1174112174_1174112177 -7 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data
1174112174_1174112184 18 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data
1174112174_1174112179 -5 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112179 20:48204625-48204647 TTTCGTGCTGAGCAAGCTGGGGG No data
1174112174_1174112186 24 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112186 20:48204654-48204676 TGTCCCAGCACAGGAGGGACAGG No data
1174112174_1174112180 -1 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112180 20:48204629-48204651 GTGCTGAGCAAGCTGGGGGCCGG No data
1174112174_1174112176 -8 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112176 20:48204622-48204644 GGCTTTCGTGCTGAGCAAGCTGG No data
1174112174_1174112182 15 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112182 20:48204645-48204667 GGGCCGGGATGTCCCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174112174 Original CRISPR CGAAAGCCAAAACCTCGCCT GGG (reversed) Intergenic