ID: 1174112177

View in Genome Browser
Species Human (GRCh38)
Location 20:48204623-48204645
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174112174_1174112177 -7 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data
1174112175_1174112177 -8 Left 1174112175 20:48204608-48204630 CCAGGCGAGGTTTTGGCTTTCGT No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data
1174112171_1174112177 -1 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data
1174112173_1174112177 -2 Left 1174112173 20:48204602-48204624 CCAAGCCCAGGCGAGGTTTTGGC No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data
1174112170_1174112177 0 Left 1174112170 20:48204600-48204622 CCCCAAGCCCAGGCGAGGTTTTG No data
Right 1174112177 20:48204623-48204645 GCTTTCGTGCTGAGCAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174112177 Original CRISPR GCTTTCGTGCTGAGCAAGCT GGG Intergenic
No off target data available for this crispr