ID: 1174112184

View in Genome Browser
Species Human (GRCh38)
Location 20:48204648-48204670
Sequence CCGGGATGTCCCAGCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174112175_1174112184 17 Left 1174112175 20:48204608-48204630 CCAGGCGAGGTTTTGGCTTTCGT No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data
1174112174_1174112184 18 Left 1174112174 20:48204607-48204629 CCCAGGCGAGGTTTTGGCTTTCG No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data
1174112170_1174112184 25 Left 1174112170 20:48204600-48204622 CCCCAAGCCCAGGCGAGGTTTTG No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data
1174112173_1174112184 23 Left 1174112173 20:48204602-48204624 CCAAGCCCAGGCGAGGTTTTGGC No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data
1174112171_1174112184 24 Left 1174112171 20:48204601-48204623 CCCAAGCCCAGGCGAGGTTTTGG No data
Right 1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174112184 Original CRISPR CCGGGATGTCCCAGCACAGG AGG Intergenic
No off target data available for this crispr