ID: 1174112227

View in Genome Browser
Species Human (GRCh38)
Location 20:48204785-48204807
Sequence GTGGAGCTGGACCAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174112220_1174112227 -2 Left 1174112220 20:48204764-48204786 CCACTCAGTGGGCCGGGTATGGT No data
Right 1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG No data
1174112213_1174112227 11 Left 1174112213 20:48204751-48204773 CCCTGGGAGAAGGCCACTCAGTG No data
Right 1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG No data
1174112214_1174112227 10 Left 1174112214 20:48204752-48204774 CCTGGGAGAAGGCCACTCAGTGG No data
Right 1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174112227 Original CRISPR GTGGAGCTGGACCAGGGTGG AGG Intergenic
No off target data available for this crispr