ID: 1174116523

View in Genome Browser
Species Human (GRCh38)
Location 20:48230189-48230211
Sequence GTCCCAGGCCACTGTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174116518_1174116523 -9 Left 1174116518 20:48230175-48230197 CCCAAACTCACTGTGTCCCAGGC No data
Right 1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG No data
1174116515_1174116523 0 Left 1174116515 20:48230166-48230188 CCAGCACCTCCCAAACTCACTGT No data
Right 1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG No data
1174116513_1174116523 28 Left 1174116513 20:48230138-48230160 CCTGGCCTTTTGGGGAGGCAGGC No data
Right 1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG No data
1174116514_1174116523 23 Left 1174116514 20:48230143-48230165 CCTTTTGGGGAGGCAGGCGAGCA No data
Right 1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG No data
1174116516_1174116523 -6 Left 1174116516 20:48230172-48230194 CCTCCCAAACTCACTGTGTCCCA No data
Right 1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG No data
1174116519_1174116523 -10 Left 1174116519 20:48230176-48230198 CCAAACTCACTGTGTCCCAGGCC No data
Right 1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174116523 Original CRISPR GTCCCAGGCCACTGTGGGGT AGG Intergenic
No off target data available for this crispr