ID: 1174118395

View in Genome Browser
Species Human (GRCh38)
Location 20:48243708-48243730
Sequence GCCATCTGTAGAATTACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174118395_1174118398 27 Left 1174118395 20:48243708-48243730 CCTCAGGTAATTCTACAGATGGC No data
Right 1174118398 20:48243758-48243780 GTATGTGCATAGCTGATATTGGG No data
1174118395_1174118396 -3 Left 1174118395 20:48243708-48243730 CCTCAGGTAATTCTACAGATGGC No data
Right 1174118396 20:48243728-48243750 GGCATTGCGTTATTGAAAAATGG No data
1174118395_1174118397 26 Left 1174118395 20:48243708-48243730 CCTCAGGTAATTCTACAGATGGC No data
Right 1174118397 20:48243757-48243779 TGTATGTGCATAGCTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174118395 Original CRISPR GCCATCTGTAGAATTACCTG AGG (reversed) Intergenic
No off target data available for this crispr