ID: 1174120380

View in Genome Browser
Species Human (GRCh38)
Location 20:48260513-48260535
Sequence GCCTCAGATGTCCCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174120374_1174120380 18 Left 1174120374 20:48260472-48260494 CCAGAGCTCGGTGTCTGCCTGGG No data
Right 1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG No data
1174120371_1174120380 24 Left 1174120371 20:48260466-48260488 CCCATTCCAGAGCTCGGTGTCTG No data
Right 1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG No data
1174120377_1174120380 1 Left 1174120377 20:48260489-48260511 CCTGGGAGACTTAGGACCTTTAG No data
Right 1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG No data
1174120370_1174120380 25 Left 1174120370 20:48260465-48260487 CCCCATTCCAGAGCTCGGTGTCT No data
Right 1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG No data
1174120372_1174120380 23 Left 1174120372 20:48260467-48260489 CCATTCCAGAGCTCGGTGTCTGC No data
Right 1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174120380 Original CRISPR GCCTCAGATGTCCCCAGCCT GGG Intergenic
No off target data available for this crispr