ID: 1174121877

View in Genome Browser
Species Human (GRCh38)
Location 20:48271957-48271979
Sequence CAGGGGAAACAGCTTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174121877_1174121890 24 Left 1174121877 20:48271957-48271979 CCAATCTCAAGCTGTTTCCCCTG No data
Right 1174121890 20:48272004-48272026 CCCCTTGAGAAACACAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174121877 Original CRISPR CAGGGGAAACAGCTTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr