ID: 1174124657

View in Genome Browser
Species Human (GRCh38)
Location 20:48294994-48295016
Sequence ACTTGACTTCAGACAGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174124652_1174124657 3 Left 1174124652 20:48294968-48294990 CCAAGCTTCCATTCTCTCTCCTT No data
Right 1174124657 20:48294994-48295016 ACTTGACTTCAGACAGGACCCGG No data
1174124654_1174124657 -5 Left 1174124654 20:48294976-48294998 CCATTCTCTCTCCTTGGTACTTG No data
Right 1174124657 20:48294994-48295016 ACTTGACTTCAGACAGGACCCGG No data
1174124651_1174124657 29 Left 1174124651 20:48294942-48294964 CCTTCTGGAATAAATTCAGTGAA No data
Right 1174124657 20:48294994-48295016 ACTTGACTTCAGACAGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174124657 Original CRISPR ACTTGACTTCAGACAGGACC CGG Intergenic
No off target data available for this crispr