ID: 1174127346

View in Genome Browser
Species Human (GRCh38)
Location 20:48316633-48316655
Sequence ATTTTCATTTGTTTAATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174127346_1174127347 4 Left 1174127346 20:48316633-48316655 CCTTTAATTAAACAAATGAAAAT No data
Right 1174127347 20:48316660-48316682 ATTAAATTCACCTATCAGATTGG No data
1174127346_1174127351 30 Left 1174127346 20:48316633-48316655 CCTTTAATTAAACAAATGAAAAT No data
Right 1174127351 20:48316686-48316708 GACAAACCCTTCAAGGCTGTGGG No data
1174127346_1174127349 23 Left 1174127346 20:48316633-48316655 CCTTTAATTAAACAAATGAAAAT No data
Right 1174127349 20:48316679-48316701 TTGGCAAGACAAACCCTTCAAGG No data
1174127346_1174127350 29 Left 1174127346 20:48316633-48316655 CCTTTAATTAAACAAATGAAAAT No data
Right 1174127350 20:48316685-48316707 AGACAAACCCTTCAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174127346 Original CRISPR ATTTTCATTTGTTTAATTAA AGG (reversed) Intergenic
No off target data available for this crispr