ID: 1174127349

View in Genome Browser
Species Human (GRCh38)
Location 20:48316679-48316701
Sequence TTGGCAAGACAAACCCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174127346_1174127349 23 Left 1174127346 20:48316633-48316655 CCTTTAATTAAACAAATGAAAAT No data
Right 1174127349 20:48316679-48316701 TTGGCAAGACAAACCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174127349 Original CRISPR TTGGCAAGACAAACCCTTCA AGG Intergenic
No off target data available for this crispr