ID: 1174130272

View in Genome Browser
Species Human (GRCh38)
Location 20:48339618-48339640
Sequence GTACAGACCTTGGCAACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174130267_1174130272 15 Left 1174130267 20:48339580-48339602 CCGGGCAGGGGACACAGATGGGC No data
Right 1174130272 20:48339618-48339640 GTACAGACCTTGGCAACAAGAGG No data
1174130270_1174130272 -7 Left 1174130270 20:48339602-48339624 CCAGGCAGTTGGTATTGTACAGA No data
Right 1174130272 20:48339618-48339640 GTACAGACCTTGGCAACAAGAGG No data
1174130263_1174130272 27 Left 1174130263 20:48339568-48339590 CCACGACAGCTACCGGGCAGGGG No data
Right 1174130272 20:48339618-48339640 GTACAGACCTTGGCAACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174130272 Original CRISPR GTACAGACCTTGGCAACAAG AGG Intergenic
No off target data available for this crispr