ID: 1174131404

View in Genome Browser
Species Human (GRCh38)
Location 20:48345881-48345903
Sequence ACTCACAGTGTGACACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174131404_1174131407 18 Left 1174131404 20:48345881-48345903 CCTGCAAGTGTCACACTGTGAGT No data
Right 1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174131404 Original CRISPR ACTCACAGTGTGACACTTGC AGG (reversed) Intergenic
No off target data available for this crispr