ID: 1174131406

View in Genome Browser
Species Human (GRCh38)
Location 20:48345905-48345927
Sequence ATGTTGTCATCTAGTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174131406_1174131407 -6 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG No data
1174131406_1174131414 30 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131414 20:48345958-48345980 GGGTGTGGAATGAGGCCAATTGG No data
1174131406_1174131410 10 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131410 20:48345938-48345960 AGCCAGGTGACTATAGTGAGGGG No data
1174131406_1174131412 15 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131412 20:48345943-48345965 GGTGACTATAGTGAGGGGTGTGG No data
1174131406_1174131413 22 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131413 20:48345950-48345972 ATAGTGAGGGGTGTGGAATGAGG No data
1174131406_1174131409 9 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131409 20:48345937-48345959 AAGCCAGGTGACTATAGTGAGGG No data
1174131406_1174131408 8 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131408 20:48345936-48345958 GAAGCCAGGTGACTATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174131406 Original CRISPR ATGTTGTCATCTAGTTCCTG AGG (reversed) Intergenic
No off target data available for this crispr