ID: 1174131407

View in Genome Browser
Species Human (GRCh38)
Location 20:48345922-48345944
Sequence CAACATAAACAAATGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174131406_1174131407 -6 Left 1174131406 20:48345905-48345927 CCTCAGGAACTAGATGACAACAT No data
Right 1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG No data
1174131404_1174131407 18 Left 1174131404 20:48345881-48345903 CCTGCAAGTGTCACACTGTGAGT No data
Right 1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG No data
1174131403_1174131407 19 Left 1174131403 20:48345880-48345902 CCCTGCAAGTGTCACACTGTGAG No data
Right 1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174131407 Original CRISPR CAACATAAACAAATGAAGCC AGG Intergenic
No off target data available for this crispr