ID: 1174133878

View in Genome Browser
Species Human (GRCh38)
Location 20:48365362-48365384
Sequence AGCTCTCATGTCAGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174133878_1174133886 25 Left 1174133878 20:48365362-48365384 CCCTGGGTCCTGACATGAGAGCT No data
Right 1174133886 20:48365410-48365432 TGTCAAGAGGTGGCTTGGAATGG No data
1174133878_1174133885 20 Left 1174133878 20:48365362-48365384 CCCTGGGTCCTGACATGAGAGCT No data
Right 1174133885 20:48365405-48365427 GGTGATGTCAAGAGGTGGCTTGG No data
1174133878_1174133881 -1 Left 1174133878 20:48365362-48365384 CCCTGGGTCCTGACATGAGAGCT No data
Right 1174133881 20:48365384-48365406 TGATGACCATTTATTATCACTGG No data
1174133878_1174133884 15 Left 1174133878 20:48365362-48365384 CCCTGGGTCCTGACATGAGAGCT No data
Right 1174133884 20:48365400-48365422 TCACTGGTGATGTCAAGAGGTGG No data
1174133878_1174133883 12 Left 1174133878 20:48365362-48365384 CCCTGGGTCCTGACATGAGAGCT No data
Right 1174133883 20:48365397-48365419 TTATCACTGGTGATGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174133878 Original CRISPR AGCTCTCATGTCAGGACCCA GGG (reversed) Intergenic
No off target data available for this crispr