ID: 1174134242

View in Genome Browser
Species Human (GRCh38)
Location 20:48367950-48367972
Sequence GAGCTGGGCAGAGCCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174134242_1174134246 8 Left 1174134242 20:48367950-48367972 CCGAGGCGGGCTCTGCCCAGCTC No data
Right 1174134246 20:48367981-48368003 GCTCTGCCTGACTGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174134242 Original CRISPR GAGCTGGGCAGAGCCCGCCT CGG (reversed) Intergenic
No off target data available for this crispr