ID: 1174136943

View in Genome Browser
Species Human (GRCh38)
Location 20:48386281-48386303
Sequence ACGTCCATGCAGGAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174136943_1174136949 -6 Left 1174136943 20:48386281-48386303 CCCAGCAGCTCCTGCATGGACGT No data
Right 1174136949 20:48386298-48386320 GGACGTGGTGCTATTCTCTGGGG No data
1174136943_1174136948 -7 Left 1174136943 20:48386281-48386303 CCCAGCAGCTCCTGCATGGACGT No data
Right 1174136948 20:48386297-48386319 TGGACGTGGTGCTATTCTCTGGG No data
1174136943_1174136953 29 Left 1174136943 20:48386281-48386303 CCCAGCAGCTCCTGCATGGACGT No data
Right 1174136953 20:48386333-48386355 CTGACTTCAGCCTGGCCTTCAGG No data
1174136943_1174136947 -8 Left 1174136943 20:48386281-48386303 CCCAGCAGCTCCTGCATGGACGT No data
Right 1174136947 20:48386296-48386318 ATGGACGTGGTGCTATTCTCTGG No data
1174136943_1174136951 21 Left 1174136943 20:48386281-48386303 CCCAGCAGCTCCTGCATGGACGT No data
Right 1174136951 20:48386325-48386347 GCATGCACCTGACTTCAGCCTGG No data
1174136943_1174136954 30 Left 1174136943 20:48386281-48386303 CCCAGCAGCTCCTGCATGGACGT No data
Right 1174136954 20:48386334-48386356 TGACTTCAGCCTGGCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174136943 Original CRISPR ACGTCCATGCAGGAGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr