ID: 1174140272

View in Genome Browser
Species Human (GRCh38)
Location 20:48408280-48408302
Sequence GTGGAGAGCCAGCCAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174140272_1174140278 -3 Left 1174140272 20:48408280-48408302 CCTTTCCCTGGCTGGCTCTCCAC No data
Right 1174140278 20:48408300-48408322 CACCCTGCCCAGGATGAGGCAGG No data
1174140272_1174140284 7 Left 1174140272 20:48408280-48408302 CCTTTCCCTGGCTGGCTCTCCAC No data
Right 1174140284 20:48408310-48408332 AGGATGAGGCAGGGAATCCAAGG No data
1174140272_1174140286 25 Left 1174140272 20:48408280-48408302 CCTTTCCCTGGCTGGCTCTCCAC No data
Right 1174140286 20:48408328-48408350 CAAGGACACTCAGCTACCTCAGG No data
1174140272_1174140276 -7 Left 1174140272 20:48408280-48408302 CCTTTCCCTGGCTGGCTCTCCAC No data
Right 1174140276 20:48408296-48408318 TCTCCACCCTGCCCAGGATGAGG No data
1174140272_1174140279 -2 Left 1174140272 20:48408280-48408302 CCTTTCCCTGGCTGGCTCTCCAC No data
Right 1174140279 20:48408301-48408323 ACCCTGCCCAGGATGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174140272 Original CRISPR GTGGAGAGCCAGCCAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr