ID: 1174140579

View in Genome Browser
Species Human (GRCh38)
Location 20:48410706-48410728
Sequence CTTTTACCACATATGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174140576_1174140579 20 Left 1174140576 20:48410663-48410685 CCTTACTATATATTTTTTTGTAC 0: 1
1: 1
2: 2
3: 52
4: 660
Right 1174140579 20:48410706-48410728 CTTTTACCACATATGGATCAGGG 0: 1
1: 0
2: 1
3: 20
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174140579 Original CRISPR CTTTTACCACATATGGATCA GGG Intergenic
901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG + Intergenic
905837412 1:41138691-41138713 CTTTTACAACCTATGATTCAAGG + Intronic
906289492 1:44610551-44610573 CTTTTGCCACATGTGGGTCTAGG - Intronic
909951970 1:81730964-81730986 ATTTTACCATATCTGAATCATGG - Intronic
921559875 1:216644256-216644278 CTTTTACTTCATCTGGAACATGG + Intronic
1065074997 10:22069188-22069210 CTTTAACAACAAATGGGTCAAGG - Intergenic
1071309614 10:84329762-84329784 TTTTTATCACATATGGATGACGG - Intronic
1071952834 10:90724377-90724399 CTTCTGCCACATATGACTCAGGG + Intergenic
1074222425 10:111451123-111451145 CTTGTACTAGATATGTATCATGG - Intergenic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1078315664 11:10291308-10291330 CTTTAACCTCATATGGCTTAAGG - Intronic
1080375387 11:31704122-31704144 GTCTTACCACAAATGCATCAAGG + Intronic
1080542117 11:33277236-33277258 CCTTTACCACATATAAAACATGG + Intronic
1082891379 11:58142562-58142584 CTTTTGCCAAACATTGATCAAGG + Intronic
1084291187 11:68169373-68169395 CATTTACCAAATATTTATCAAGG + Intronic
1091338015 11:134787058-134787080 TTTTTACCACATATGTCTCATGG + Intergenic
1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG + Intergenic
1112837179 13:103530388-103530410 CTTTAACCACTTCTGGATCCAGG - Intergenic
1113228711 13:108188746-108188768 CTGATGCCACGTATGGATCAGGG + Intergenic
1114575854 14:23712746-23712768 CTTTTGCCACATTTGGAGAAAGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115059405 14:29171526-29171548 CTTTTTCCACATATGGTCAAAGG - Intergenic
1116050664 14:39799058-39799080 CTATTACCACAAATGGAGCCTGG - Intergenic
1116721205 14:48498137-48498159 CTTTTTCCACATATGGCAGAAGG - Intergenic
1118615106 14:67569729-67569751 CCTTTACCACATGGAGATCATGG + Intronic
1123385954 15:19803285-19803307 CTTTTCCCACATAGGCTTCAAGG + Intergenic
1129851284 15:78795343-78795365 CTTTTATTCCATATGGAACAGGG + Intronic
1130341595 15:83003681-83003703 CTTGTACCAAATAGGTATCAAGG - Intronic
1135947533 16:26877964-26877986 TTTTCACCACATATGAACCATGG - Intergenic
1139365638 16:66431615-66431637 CTTTTACAAAATAAGGATCACGG + Intronic
1143265069 17:5630511-5630533 CCTTTACCAGATATTGATCATGG - Intergenic
1157892322 18:51429357-51429379 CATTTACCACATAAGGGTTAGGG - Intergenic
1158264501 18:55646941-55646963 ATTTTACCACATATTGTTCATGG + Intronic
1164318776 19:24119152-24119174 ATTTTTCCACATATGGTTTAAGG + Intronic
1164509896 19:28888659-28888681 CTTTTACCTGATTTGGGTCACGG - Intergenic
1166431106 19:42728861-42728883 CTTCTACCACATAGGGCTCAGGG + Intronic
1166444109 19:42844102-42844124 CTTCTACCACATAGGGCTCAGGG + Intronic
1166451547 19:42906660-42906682 CTTCTACCACATAGGGCTCAGGG + Intronic
1166463790 19:43014854-43014876 CTTCTACCACATAGGGCTCAGGG + Intronic
1166469942 19:43071438-43071460 CTTCTACCACATAGGGCTCAGGG + Intronic
1166481077 19:43174953-43174975 CCTCTACCACATAGGGCTCAGGG + Intronic
1166490659 19:43257940-43257962 CTTCTACCACATAGGGCTCAGGG + Intronic
1168677632 19:58290445-58290467 CTTTTGCCACATAAGGTTCCAGG + Intronic
932386262 2:71335857-71335879 CCTTTACCACATATGCATGGGGG - Intronic
933848964 2:86350141-86350163 CTCTTACCACACATGCATCATGG + Intergenic
939088153 2:137746506-137746528 ATTCTACCACATATTCATCAGGG - Intergenic
939599374 2:144169500-144169522 ATATTACCTCTTATGGATCATGG + Intronic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943528003 2:189041879-189041901 CTTTTACCATGCATGGATGATGG - Intronic
943843393 2:192608024-192608046 CTATTACCACTTATGGAAAAGGG - Intergenic
944287075 2:197963194-197963216 ATTGTACCACCTATGGATGAAGG + Intronic
945043530 2:205762598-205762620 TTTCTACCACATATGCAGCATGG - Intronic
945512212 2:210716647-210716669 CTTTTACCTCCTATGGTCCATGG + Intergenic
947436039 2:230072972-230072994 CTACTAGCACATATGGTTCATGG - Intergenic
1169627522 20:7588931-7588953 CTTTTATGACATATAAATCAAGG + Intergenic
1174140579 20:48410706-48410728 CTTTTACCACATATGGATCAGGG + Intergenic
1174633435 20:51978351-51978373 CTCTTACCACACATGTGTCAGGG - Intergenic
1174932838 20:54834121-54834143 TTTTGTCCACATATGTATCATGG - Intergenic
1176176363 20:63727824-63727846 TTTTTCCTAAATATGGATCATGG + Intronic
1177319055 21:19496148-19496170 CCTTTACCCCATAAGGAGCATGG + Intergenic
960647483 3:119903450-119903472 CTGCTACTACATATTGATCACGG + Intronic
963960992 3:151309058-151309080 CTTTTACTACATATGGGTGAGGG - Intronic
964018283 3:151975223-151975245 CTTTTATCACATAAAAATCATGG + Intergenic
964196118 3:154066794-154066816 CTTTTACCAAAGAAGGGTCATGG - Intergenic
964304007 3:155321433-155321455 CTTATACAAAATATGGAACAAGG - Intergenic
964971222 3:162564853-162564875 CTTTTACAACATGTGGATGCTGG + Intergenic
976426251 4:84906671-84906693 CTTGTACAACCTATGGCTCATGG + Intronic
981816893 4:148840932-148840954 ATTTTAAAACATATGGATAAAGG - Intergenic
985032484 4:185803557-185803579 CTTTTACAACATAAGGGTGATGG + Intronic
985306663 4:188549673-188549695 ATTTTATCACATATGAAGCACGG - Intergenic
986023370 5:3825716-3825738 CTTTTAATCCATCTGGATCATGG - Intergenic
986238226 5:5932667-5932689 ATTTTACCACATATGAGGCAGGG + Intergenic
987515613 5:18903463-18903485 CATCTACCACAAATGGATAATGG + Intergenic
988017985 5:25584422-25584444 CTTTTACCACAAAGGGATACTGG + Intergenic
989126844 5:38062623-38062645 CTTTTACAACATATGTCACATGG - Intergenic
991322843 5:65394719-65394741 GATTTACCACACATGCATCATGG - Intronic
992637631 5:78740138-78740160 CTCTTACCACATCTGGATGAAGG - Intronic
992889561 5:81191420-81191442 TTTTTCCCTCCTATGGATCAGGG + Intronic
993123961 5:83809101-83809123 CTTTTTCTACATATGGAATATGG + Intergenic
993535704 5:89083415-89083437 CTTTTCTCACATTTGCATCACGG - Intergenic
993763367 5:91824595-91824617 ATTTTACCAAATATGTCTCAAGG + Intergenic
997092693 5:130876044-130876066 CTTTTAACACTTATAGATGAGGG - Intergenic
998094291 5:139388574-139388596 ATTTTGCCACATCTGGAACAAGG + Exonic
998225479 5:140323259-140323281 CTTCTCCCACACATGGCTCATGG - Intergenic
998254400 5:140573742-140573764 CTTTTACCACCTATGGAGAAAGG + Intronic
999786604 5:154896238-154896260 CTCTTACCACACTTGGAACACGG - Exonic
999927017 5:156389925-156389947 CTTATGCCACATATTGATAATGG + Intronic
1000651926 5:163829448-163829470 CTTTTTCTACATTTGGGTCAAGG + Intergenic
1009252464 6:61321983-61322005 CTTTTACAACATAGGCCTCAAGG - Intergenic
1015360733 6:132336307-132336329 CTTTTTCCAGAGATGGATTACGG - Intronic
1016083436 6:139882849-139882871 CTTTTACCACATATTCATCTGGG - Intergenic
1018352167 6:162971295-162971317 CATTTACAAAATATGGATCATGG + Intronic
1020119777 7:5496465-5496487 CTTTAGCCACCTATGGATCCAGG - Intronic
1020252462 7:6480591-6480613 TTTTTACCCCATAAGGATCAGGG - Intronic
1020780202 7:12508412-12508434 TATTTACCACATAAGCATCATGG - Intergenic
1020900615 7:13998697-13998719 CTGTTTCCACATGTGGATAATGG + Intergenic
1021613957 7:22483312-22483334 GTTATTCCACATATGGATGAGGG + Intronic
1021618377 7:22525600-22525622 CTTTGAGCACATATAGATAATGG - Intronic
1022694785 7:32693576-32693598 CTTTGAGCACATATAGATAATGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025743749 7:64224954-64224976 CTTTGACCACATATTTACCAGGG + Intronic
1027885756 7:83902187-83902209 ATTTTACCACATAGAGAACATGG - Intergenic
1028374306 7:90130521-90130543 CTTTGAGCACATATAGATAATGG + Intergenic
1029236852 7:99127256-99127278 CTTTTTGCACATACGGATCAGGG - Intronic
1031847576 7:126824855-126824877 ATTTTACCACATATGAGTTAGGG - Intronic
1038157815 8:25007452-25007474 CTTCTACCACACACGCATCAGGG - Intergenic
1038255404 8:25946627-25946649 CTTTGACCACCTGTGCATCACGG + Intronic
1039127887 8:34224416-34224438 TTTTTACCACATATAAATAATGG + Intergenic
1040130998 8:43796447-43796469 GTTTTACCCCATAGGCATCATGG - Intergenic
1043916140 8:85924661-85924683 CTGTTATCACATCTGGAGCAAGG + Intergenic
1047441176 8:124880011-124880033 CTGTTACCACAAATGGATATTGG - Intergenic
1048833822 8:138499763-138499785 ATTTTACCACATGGGGAACAAGG - Intergenic
1052223298 9:26054085-26054107 CTTATATCACATATTTATCAAGG + Intergenic
1052225839 9:26084862-26084884 CTTTTTCCACATATAATTCAAGG - Intergenic
1058220398 9:102292696-102292718 CATTTATCACATATGGATCAGGG + Intergenic
1061069072 9:128297546-128297568 CATTTACCTCATTTGGATAATGG - Intergenic
1061412419 9:130428806-130428828 CTGTTCCCCCATATGAATCAAGG + Intronic
1186039816 X:5463477-5463499 GTTTAACCAAACATGGATCACGG - Intergenic
1187486396 X:19708201-19708223 CTTTTGAAACATATTGATCAGGG - Intronic
1189408575 X:40748644-40748666 CTTTTACCAAATACTGATGAAGG - Intergenic
1192084480 X:68082666-68082688 GTTGTTCCACATATGGAGCATGG + Intronic
1192836211 X:74802170-74802192 CTTTTGCCACATATTGATTGTGG + Intronic
1194794097 X:98188533-98188555 CTTTTACCAAACATGGTTCCAGG - Intergenic
1197771688 X:130093380-130093402 ATTATATCACATATGGGTCAAGG + Intronic
1197779041 X:130141361-130141383 CCTTTTCCACACATGGGTCAGGG - Intronic
1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG + Intergenic
1198817472 X:140608107-140608129 CTTTTTCCACAAAGGCATCAAGG - Intergenic