ID: 1174141114

View in Genome Browser
Species Human (GRCh38)
Location 20:48414421-48414443
Sequence CGATGCTCTGCACAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174141111_1174141114 -4 Left 1174141111 20:48414402-48414424 CCCTCACGGGTCTCACTGACGAT No data
Right 1174141114 20:48414421-48414443 CGATGCTCTGCACAGCCTGGAGG No data
1174141112_1174141114 -5 Left 1174141112 20:48414403-48414425 CCTCACGGGTCTCACTGACGATG No data
Right 1174141114 20:48414421-48414443 CGATGCTCTGCACAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174141114 Original CRISPR CGATGCTCTGCACAGCCTGG AGG Intergenic
No off target data available for this crispr