ID: 1174143482

View in Genome Browser
Species Human (GRCh38)
Location 20:48433746-48433768
Sequence CCCCTTGGGCACGTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2645
Summary {0: 3, 1: 29, 2: 483, 3: 849, 4: 1281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174143477_1174143482 -6 Left 1174143477 20:48433729-48433751 CCAAGCTATAGTCTGACCCCCTT No data
Right 1174143482 20:48433746-48433768 CCCCTTGGGCACGTGTTCTCAGG 0: 3
1: 29
2: 483
3: 849
4: 1281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174143482 Original CRISPR CCCCTTGGGCACGTGTTCTC AGG Intergenic
Too many off-targets to display for this crispr