ID: 1174143639

View in Genome Browser
Species Human (GRCh38)
Location 20:48434954-48434976
Sequence CATGAGATGCAGAGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174143639_1174143647 11 Left 1174143639 20:48434954-48434976 CCTGCTCCCCTCTGCATCTCATG No data
Right 1174143647 20:48434988-48435010 TGCTGACTGCGCTCCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174143639 Original CRISPR CATGAGATGCAGAGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr