ID: 1174143857

View in Genome Browser
Species Human (GRCh38)
Location 20:48436633-48436655
Sequence AATTATATTGAGAAATTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174143857_1174143862 26 Left 1174143857 20:48436633-48436655 CCTACCAATTTCTCAATATAATT No data
Right 1174143862 20:48436682-48436704 TTTTAAAGAAAATATGGCCTTGG No data
1174143857_1174143861 20 Left 1174143857 20:48436633-48436655 CCTACCAATTTCTCAATATAATT No data
Right 1174143861 20:48436676-48436698 TTTTTTTTTTAAAGAAAATATGG 0: 2
1: 24
2: 203
3: 1296
4: 7076
1174143857_1174143864 30 Left 1174143857 20:48436633-48436655 CCTACCAATTTCTCAATATAATT No data
Right 1174143864 20:48436686-48436708 AAAGAAAATATGGCCTTGGTGGG No data
1174143857_1174143863 29 Left 1174143857 20:48436633-48436655 CCTACCAATTTCTCAATATAATT No data
Right 1174143863 20:48436685-48436707 TAAAGAAAATATGGCCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174143857 Original CRISPR AATTATATTGAGAAATTGGT AGG (reversed) Intergenic
No off target data available for this crispr