ID: 1174148110

View in Genome Browser
Species Human (GRCh38)
Location 20:48466623-48466645
Sequence CATGGTCACAGCTTGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174148106_1174148110 21 Left 1174148106 20:48466579-48466601 CCACACAACACTTTCATTACTTT No data
Right 1174148110 20:48466623-48466645 CATGGTCACAGCTTGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174148110 Original CRISPR CATGGTCACAGCTTGCTGCA AGG Intergenic
No off target data available for this crispr