ID: 1174148141

View in Genome Browser
Species Human (GRCh38)
Location 20:48466864-48466886
Sequence CAACCTTTCTAGAGGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174148141_1174148144 0 Left 1174148141 20:48466864-48466886 CCAATTGCCCTCTAGAAAGGTTG No data
Right 1174148144 20:48466887-48466909 TACCAATGAACTCACCCAAGAGG No data
1174148141_1174148146 3 Left 1174148141 20:48466864-48466886 CCAATTGCCCTCTAGAAAGGTTG No data
Right 1174148146 20:48466890-48466912 CAATGAACTCACCCAAGAGGTGG No data
1174148141_1174148147 4 Left 1174148141 20:48466864-48466886 CCAATTGCCCTCTAGAAAGGTTG No data
Right 1174148147 20:48466891-48466913 AATGAACTCACCCAAGAGGTGGG No data
1174148141_1174148148 5 Left 1174148141 20:48466864-48466886 CCAATTGCCCTCTAGAAAGGTTG No data
Right 1174148148 20:48466892-48466914 ATGAACTCACCCAAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174148141 Original CRISPR CAACCTTTCTAGAGGGCAAT TGG (reversed) Intergenic
No off target data available for this crispr