ID: 1174153446

View in Genome Browser
Species Human (GRCh38)
Location 20:48501938-48501960
Sequence CTGTGTCAGTTGAAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174153446_1174153453 10 Left 1174153446 20:48501938-48501960 CCCTCAAACTTCAACTGACACAG No data
Right 1174153453 20:48501971-48501993 CCACAGTTAAACAGCAGCATGGG No data
1174153446_1174153451 9 Left 1174153446 20:48501938-48501960 CCCTCAAACTTCAACTGACACAG No data
Right 1174153451 20:48501970-48501992 CCCACAGTTAAACAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174153446 Original CRISPR CTGTGTCAGTTGAAGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr