ID: 1174153534

View in Genome Browser
Species Human (GRCh38)
Location 20:48502445-48502467
Sequence GTGTGTCAGTTGAAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174153534_1174153542 10 Left 1174153534 20:48502445-48502467 CCCTCAAACTTCAACTGACACAC No data
Right 1174153542 20:48502478-48502500 CCACAGTTAAACAGCAGCATGGG No data
1174153534_1174153540 9 Left 1174153534 20:48502445-48502467 CCCTCAAACTTCAACTGACACAC No data
Right 1174153540 20:48502477-48502499 CCCACAGTTAAACAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174153534 Original CRISPR GTGTGTCAGTTGAAGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr