ID: 1174153602

View in Genome Browser
Species Human (GRCh38)
Location 20:48502870-48502892
Sequence CTGGAGAACCAGAAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174153602_1174153604 -7 Left 1174153602 20:48502870-48502892 CCAGCTCCTTTCTGGTTCTCCAG No data
Right 1174153604 20:48502886-48502908 TCTCCAGTTCCATAACACTCAGG No data
1174153602_1174153607 24 Left 1174153602 20:48502870-48502892 CCAGCTCCTTTCTGGTTCTCCAG No data
Right 1174153607 20:48502917-48502939 GCAGCACCCACTCCTCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174153602 Original CRISPR CTGGAGAACCAGAAAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr