ID: 1174162486

View in Genome Browser
Species Human (GRCh38)
Location 20:48561547-48561569
Sequence GAGGACAGACTGAAGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174162480_1174162486 20 Left 1174162480 20:48561504-48561526 CCAAAAAAAAAAAGTCATTCATT No data
Right 1174162486 20:48561547-48561569 GAGGACAGACTGAAGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174162486 Original CRISPR GAGGACAGACTGAAGACCCC TGG Intergenic
No off target data available for this crispr