ID: 1174169455

View in Genome Browser
Species Human (GRCh38)
Location 20:48606997-48607019
Sequence TGGGCTCCCCCAGCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174169455_1174169461 -6 Left 1174169455 20:48606997-48607019 CCCACCTGGGCTGGGGGAGCCCA No data
Right 1174169461 20:48607014-48607036 AGCCCAGAGCTGCCTGGGCAGGG No data
1174169455_1174169466 14 Left 1174169455 20:48606997-48607019 CCCACCTGGGCTGGGGGAGCCCA No data
Right 1174169466 20:48607034-48607056 GGGATGAGCATAGATGGTGACGG No data
1174169455_1174169460 -7 Left 1174169455 20:48606997-48607019 CCCACCTGGGCTGGGGGAGCCCA No data
Right 1174169460 20:48607013-48607035 GAGCCCAGAGCTGCCTGGGCAGG No data
1174169455_1174169465 8 Left 1174169455 20:48606997-48607019 CCCACCTGGGCTGGGGGAGCCCA No data
Right 1174169465 20:48607028-48607050 TGGGCAGGGATGAGCATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174169455 Original CRISPR TGGGCTCCCCCAGCCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr