ID: 1174170883

View in Genome Browser
Species Human (GRCh38)
Location 20:48617633-48617655
Sequence GGGCATCGGTGGTGACACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174170870_1174170883 29 Left 1174170870 20:48617581-48617603 CCGAGGCCCATCTGGCGGCTCCT No data
Right 1174170883 20:48617633-48617655 GGGCATCGGTGGTGACACTGAGG No data
1174170876_1174170883 9 Left 1174170876 20:48617601-48617623 CCTCATTCTGGGATCAGGCTGAA No data
Right 1174170883 20:48617633-48617655 GGGCATCGGTGGTGACACTGAGG No data
1174170871_1174170883 23 Left 1174170871 20:48617587-48617609 CCCATCTGGCGGCTCCTCATTCT No data
Right 1174170883 20:48617633-48617655 GGGCATCGGTGGTGACACTGAGG No data
1174170872_1174170883 22 Left 1174170872 20:48617588-48617610 CCATCTGGCGGCTCCTCATTCTG No data
Right 1174170883 20:48617633-48617655 GGGCATCGGTGGTGACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174170883 Original CRISPR GGGCATCGGTGGTGACACTG AGG Intergenic
No off target data available for this crispr