ID: 1174171005

View in Genome Browser
Species Human (GRCh38)
Location 20:48618247-48618269
Sequence GTTCCCGGTGTCGGGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174171005_1174171016 8 Left 1174171005 20:48618247-48618269 CCTCCAACCCCGACACCGGGAAC No data
Right 1174171016 20:48618278-48618300 GGGAGCCCATGCTGCAGATGGGG No data
1174171005_1174171015 7 Left 1174171005 20:48618247-48618269 CCTCCAACCCCGACACCGGGAAC No data
Right 1174171015 20:48618277-48618299 TGGGAGCCCATGCTGCAGATGGG No data
1174171005_1174171014 6 Left 1174171005 20:48618247-48618269 CCTCCAACCCCGACACCGGGAAC No data
Right 1174171014 20:48618276-48618298 TTGGGAGCCCATGCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174171005 Original CRISPR GTTCCCGGTGTCGGGGTTGG AGG (reversed) Intergenic