ID: 1174172298

View in Genome Browser
Species Human (GRCh38)
Location 20:48625274-48625296
Sequence GGGCTGGTGGCCCCAGTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174172290_1174172298 26 Left 1174172290 20:48625225-48625247 CCAGAGATTTCATGCCATATAAA 0: 1
1: 0
2: 2
3: 9
4: 203
Right 1174172298 20:48625274-48625296 GGGCTGGTGGCCCCAGTTCCAGG 0: 1
1: 0
2: 0
3: 44
4: 328
1174172291_1174172298 12 Left 1174172291 20:48625239-48625261 CCATATAAATAAAGTCAGAGCAA 0: 1
1: 1
2: 1
3: 31
4: 409
Right 1174172298 20:48625274-48625296 GGGCTGGTGGCCCCAGTTCCAGG 0: 1
1: 0
2: 0
3: 44
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174172298 Original CRISPR GGGCTGGTGGCCCCAGTTCC AGG Exonic
900203348 1:1420864-1420886 GGGCTGGGGGCACCTGCTCCAGG - Exonic
900408927 1:2504207-2504229 GGGCAGGTGGCCCAGGGTCCGGG - Exonic
900474037 1:2868057-2868079 GGGCTTGTGGCCCCCGGCCCTGG + Intergenic
900843083 1:5071462-5071484 GGGCTGGTGGTCCTCCTTCCTGG + Intergenic
902181995 1:14696459-14696481 GGGCTGGTGGAACCAGGTCATGG + Intronic
903005029 1:20292831-20292853 GGGCTGGTGGTCACTGTGCCCGG + Intronic
904756664 1:32771879-32771901 GGGCCGATGGCCCCAGTGCTGGG - Exonic
905301809 1:36990783-36990805 GAGTTGGTGGCCAGAGTTCCAGG + Intronic
905544402 1:38786287-38786309 AGGCTTGTGGCTCCAGCTCCAGG + Intergenic
905654856 1:39679783-39679805 AAGATGGTGGTCCCAGTTCCTGG + Exonic
906061614 1:42952786-42952808 GGGCTGGAGGGCCCAGTTCAAGG - Intronic
907275199 1:53313177-53313199 GGGCTGGTGCCCCCAGGGCGTGG + Intronic
908677896 1:66626685-66626707 GGGCTGGAGTCTCAAGTTCCCGG - Intronic
910289784 1:85588870-85588892 GGTCTTGGGGCCCCAATTCCAGG + Intergenic
912412205 1:109487166-109487188 AGGCTGGTGGCCACGGCTCCGGG - Exonic
913579386 1:120210841-120210863 GGGCTGGGGACCCCTGTTCTAGG - Intergenic
913628786 1:120687547-120687569 GGGCTGGGGACCCCTGTTCTAGG + Intergenic
913665928 1:121048898-121048920 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
914017326 1:143832174-143832196 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
914050520 1:144126630-144126652 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
914128662 1:144838815-144838837 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
914226113 1:145720940-145720962 GCGCTGGTGGCCCCAGGGCTCGG - Intronic
914561321 1:148822268-148822290 GGGCTGGGGACCCCTGTTCTAGG - Intronic
914611513 1:149307940-149307962 GGGCTGGGGACCCCTGTTCTAGG + Intergenic
914655937 1:149740706-149740728 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
915444984 1:155969485-155969507 GGGCTGGCTGCCCCAGAGCCTGG - Intronic
915650038 1:157302960-157302982 GGGCAGGTGGCCCGAGGTTCTGG - Intergenic
916495710 1:165344898-165344920 GGCCTGGGGCCCCCAGCTCCAGG - Intronic
917682688 1:177384331-177384353 TGCCTGGTGACCCCAGTTCAGGG + Intergenic
921252468 1:213310835-213310857 GGGCTGGTGGCACGTGTTTCTGG + Intergenic
923127068 1:231041198-231041220 CGGCTGGGGGCCCCAGACCCGGG + Intergenic
1063187751 10:3665980-3666002 GGTCTGGTGGCCCCAGGGCCAGG - Intergenic
1065385388 10:25128540-25128562 GAGCTGGTGGCACCACTTGCGGG - Intergenic
1069685700 10:70317086-70317108 GGGCTTGGAGCCCCAGATCCAGG + Intronic
1069894728 10:71673301-71673323 GGTGTGGAGGCCTCAGTTCCAGG - Intronic
1072448008 10:95516124-95516146 GGCCTGGTGGCTCCAGATCTGGG + Intronic
1073459886 10:103660440-103660462 GAGCTGGAGGCCCCAGGACCTGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1075402953 10:122173905-122173927 TGGCTGCTGGCCCCAGGTCATGG - Intronic
1076133872 10:128031353-128031375 GGGCTGCAGGCCTCAGCTCCGGG + Intronic
1076223549 10:128754885-128754907 GGGCTGGTAGCCGGAGTTGCAGG + Intergenic
1076884342 10:133254760-133254782 AGCCCGGTGGCCCCAGCTCCTGG - Intergenic
1077060530 11:615894-615916 GGTCTGGGGTCCCCAGTACCTGG + Intronic
1077074955 11:696093-696115 GCTCTGGGGGCCCCAGTCCCCGG + Intronic
1077093958 11:791590-791612 GGGCTGGGGGCCCCCGGGCCTGG - Exonic
1077186306 11:1236876-1236898 GTGCCTGTGGCCCCAGCTCCAGG + Intronic
1077219193 11:1407951-1407973 GGGCAGGTGGGCTCAGCTCCAGG - Intronic
1077353458 11:2103701-2103723 AGGCCTGTGTCCCCAGTTCCCGG - Intergenic
1078095044 11:8291678-8291700 AGGCAGGTGGCCCCTGTTTCCGG + Intergenic
1078345434 11:10544047-10544069 GGGCGGGTGGCTCCAGGTGCTGG + Intergenic
1078934283 11:15938383-15938405 GCGCTGGTGACGCCAGCTCCGGG + Intergenic
1079136869 11:17780341-17780363 CTGCTGGTGGCCCCTGCTCCAGG + Intronic
1081083268 11:38769035-38769057 GTGCAGATGGCCCCAGTTCAGGG - Intergenic
1081576683 11:44323065-44323087 GGGCTAGTGGCCTCAGCTCCAGG + Intergenic
1082278503 11:50246405-50246427 GGGATCGTGGCCTCAGCTCCAGG + Intergenic
1083019581 11:59493184-59493206 GGTCTGCTGGCCCCCGCTCCAGG + Intergenic
1083815226 11:65128818-65128840 GCCCTTGTGGCCCCAGTGCCTGG + Intronic
1084514447 11:69628690-69628712 GGGCTGGGGACTGCAGTTCCTGG + Intergenic
1085711171 11:78830337-78830359 GGGCTGCTGGGCCCAGCCCCTGG - Intronic
1088319856 11:108544314-108544336 GGGATGGTGGTCCCAGCTACTGG - Intronic
1089300689 11:117497074-117497096 GGGCATGTGTCGCCAGTTCCAGG - Intronic
1089447146 11:118562311-118562333 GGGCTGGTAGTCCCAGCTACCGG + Intronic
1089602333 11:119623664-119623686 GGGCAGCTGGCCCCAGGTCGTGG + Intronic
1089619311 11:119713443-119713465 GGACTTGAGGCCCCAATTCCTGG + Intronic
1089743271 11:120599716-120599738 GGGGTGTGGGCCTCAGTTCCAGG + Intronic
1090974622 11:131670933-131670955 GGGCTGGGGGCCACATTCCCTGG - Intronic
1091133220 11:133164354-133164376 TTGTTGATGGCCCCAGTTCCAGG - Intronic
1091205398 11:133817621-133817643 GGGCTGGTGGCCTGAGTCTCAGG - Intergenic
1091343346 11:134836916-134836938 GGGCTGTTGAACCCAGGTCCTGG + Intergenic
1091581542 12:1793505-1793527 GGGCTGGTGGCCCCTGGCTCCGG - Exonic
1091780158 12:3208509-3208531 GGGCTGGTGGTCACAGTGCGGGG + Intronic
1093181010 12:15966912-15966934 GAGCAGGTGGCCCCGGGTCCAGG - Intronic
1094740316 12:33281294-33281316 GGGCTGGTTCCCCCAATACCTGG - Intergenic
1095808128 12:46343442-46343464 GTGCTGGGGTCCCCAGTTTCAGG - Intergenic
1098581339 12:72102823-72102845 GGGCTTGTTGCCCCAGTTGGTGG + Intronic
1098678619 12:73321895-73321917 GTGCTGGTGGACACAGTTCTGGG - Intergenic
1101295853 12:103423156-103423178 GGGCTGGGGGCCCCAGGGCAAGG - Intronic
1101914756 12:108887446-108887468 GGTCTGTTGGCTCCAGTCCCTGG - Exonic
1102958111 12:117072647-117072669 GGGCTGGGGGCTCCACTTGCTGG + Intronic
1103737482 12:123069852-123069874 GGGCAGGTGACCCAACTTCCAGG + Intronic
1103779961 12:123391881-123391903 GGGCTCCTGTCCCCAGTTCAGGG - Intronic
1104608637 12:130208858-130208880 TGGCTGGAGGCCTCAGTTCCTGG - Intergenic
1104662604 12:130621855-130621877 GGCCTGCTGGCCTCAGTACCAGG - Intronic
1104971236 12:132531739-132531761 AGGCTGGAGGCCCCAGTCACAGG - Intronic
1105701818 13:22940152-22940174 GGGCAGAGGGCCCCACTTCCTGG - Intergenic
1105854442 13:24361937-24361959 GGGCAGAGGGCCCCACTTCCTGG - Intergenic
1108035997 13:46291142-46291164 GGACAGGTAGCTCCAGTTCCTGG - Intergenic
1108212278 13:48150722-48150744 TGGCTTGTGGCCCCATTTCCTGG - Intergenic
1109390512 13:61685496-61685518 GTGGTGGTGGCACCAGTGCCTGG - Intergenic
1119406496 14:74402612-74402634 GGCCAGGTGGCCTCAGTTCCTGG + Intergenic
1121175698 14:91889254-91889276 GGGCTGGTGGCCTCAGCCTCTGG + Intronic
1121235472 14:92388713-92388735 GGGCAGGTGGTACCAGTTCTAGG + Intronic
1121694324 14:95900498-95900520 GGGCTGCTGGCCCCAGTTGGTGG + Intergenic
1121870393 14:97401786-97401808 GGGATGCTGGCTCCAGTGCCAGG + Intergenic
1122348731 14:101075966-101075988 GGGCTGCTGGGCTCTGTTCCGGG - Intergenic
1123068601 14:105630261-105630283 CAGCTGGTGGCCCTGGTTCCTGG - Intergenic
1123071879 14:105646037-105646059 GTGCTGGTGGCCCTGGCTCCTGG + Intergenic
1123091543 14:105744313-105744335 GTGCTGGTGGCCCTGGCTCCTGG + Intergenic
1123420395 15:20125940-20125962 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
1123445464 15:20327584-20327606 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
1123529619 15:21132476-21132498 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
1124414548 15:29464313-29464335 GTGCAGGTGCCCCCAGTTGCAGG - Intronic
1126097671 15:45100807-45100829 GGGCAGGGGGCCCCAGTCCCTGG + Exonic
1126435846 15:48636706-48636728 GGGCTGCAGGCGCCAGTGCCTGG + Intronic
1126848554 15:52784325-52784347 AGGCTGGTCGCCCCAGCTACCGG + Intronic
1128422239 15:67504296-67504318 GGGCTGGGGAGACCAGTTCCTGG - Intergenic
1128633611 15:69288765-69288787 GGCCTGGTTGCCCCACTGCCTGG - Intergenic
1129120752 15:73394971-73394993 GAGCAGCTGGCCCCAGTTCTGGG - Intergenic
1129605081 15:77020927-77020949 GGGCTGGTGGCCCACCCTCCAGG + Intronic
1130260275 15:82348960-82348982 GGGCTGGGGGACCCAGGTCCTGG + Intronic
1130268455 15:82430473-82430495 GGGCTGGGGGACCCAGGTCCTGG - Intronic
1130280958 15:82520047-82520069 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130472328 15:84236228-84236250 GGGCTGGGGGACCCAGGTCCTGG - Intronic
1130479819 15:84350799-84350821 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130483951 15:84387232-84387254 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130491951 15:84437330-84437352 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1130503565 15:84516370-84516392 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1130594626 15:85240864-85240886 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1132109353 15:99091107-99091129 GGGCTGGTGAATCCACTTCCAGG + Intergenic
1132567792 16:631210-631232 GGGCTGGTGGCCACACCCCCCGG + Exonic
1132712973 16:1277431-1277453 GGGCCTGTGGCCCCTGTCCCGGG - Intergenic
1132846071 16:2001481-2001503 GGGATTGTGGCCAGAGTTCCTGG - Intronic
1133019920 16:2962887-2962909 GTGCTGGAGGCCCCAGCTCAGGG + Intergenic
1133036489 16:3036679-3036701 GGGCTGGAGGCCCCAACACCTGG - Intronic
1133040556 16:3058184-3058206 GGGCTGGAGGCGCCAGAACCAGG - Exonic
1133234590 16:4382030-4382052 GGGCTGGGGGCCTCAGTGGCCGG - Exonic
1135222126 16:20622671-20622693 GGGCTGGGGGACAGAGTTCCTGG + Intronic
1136355850 16:29744529-29744551 GGTCTGGGGGCCCAAGTTGCTGG + Exonic
1138162956 16:54773401-54773423 TGCCAGGTGGCCCCACTTCCAGG + Intergenic
1138455355 16:57117641-57117663 GAGGTGGTGGCCCGAGGTCCCGG - Intronic
1139504710 16:67393144-67393166 GGACGGGTGGCTCCAGTTCACGG - Intronic
1139509028 16:67416050-67416072 GAGCCGGTGGCCTGAGTTCCAGG - Intronic
1139868081 16:70079630-70079652 TGGCTGCAGGGCCCAGTTCCGGG + Intergenic
1141429688 16:83965253-83965275 GGGCTGCTGGGCCTGGTTCCTGG - Exonic
1141463353 16:84191395-84191417 GGGCGGGTGGCCCCAGGTCTCGG + Exonic
1141618868 16:85225972-85225994 TGGCTGGAGGCCTCAGTTCCTGG + Intergenic
1142150955 16:88512351-88512373 GGGCTGGTGCCCACCTTTCCAGG - Intronic
1142237446 16:88928886-88928908 GCGCTGCTGGCCCCAGTGCCTGG - Intronic
1143557035 17:7668292-7668314 GGGCTGGGGGGCCCAGTGCCCGG - Intronic
1143691073 17:8566496-8566518 TGGCTGGAGGCCTCAGTTCCTGG - Intronic
1144943014 17:18954349-18954371 GGGCTGGTGGCCCAAGTCACTGG - Intronic
1145266582 17:21382685-21382707 GGGCTGGTGGCCCCTTTTGTGGG + Intronic
1146008755 17:29178477-29178499 GGGGTTGTGGCCTCAATTCCAGG - Intronic
1146379977 17:32321230-32321252 GGGCTGGAGGCCCAAGGTCGGGG + Exonic
1146674340 17:34762947-34762969 TGGCTGGTGGCCTCAATTCTGGG - Intergenic
1147115321 17:38294918-38294940 GGCATGGTGGCCCCAGCTACTGG - Intergenic
1147176131 17:38657354-38657376 GGGATGGTGACGCCAGTTCCTGG - Intergenic
1147266555 17:39237918-39237940 GGGCTGGATCCCCCAGGTCCCGG + Intergenic
1148147260 17:45373691-45373713 GGCCTGGTGGCCCCAGCCCAGGG - Intergenic
1148414358 17:47494674-47494696 GGCATGGTGGCCCCAGCTACTGG + Intergenic
1148691237 17:49528170-49528192 GTGCTAGAGGCCCCAGATCCTGG + Intergenic
1149596830 17:57869175-57869197 GGGTTGGCGTCGCCAGTTCCTGG + Exonic
1150103931 17:62447940-62447962 TGCCTGGGGGCCCCAGTGCCTGG - Intronic
1151660934 17:75517535-75517557 GAGCTGTTGGCCCCACTTCCAGG + Exonic
1152118990 17:78406630-78406652 GGGCAGGTGGCCCCAGCCCGTGG + Intronic
1152590242 17:81208232-81208254 GGTGTGGTGGCCGCAGTTCTTGG + Intronic
1152759268 17:82099507-82099529 GGGCCGGGGGCCCCAGTCTCCGG - Intergenic
1152790051 17:82273830-82273852 GGGCTGGCGGCCCGAGGTCCCGG - Intergenic
1153474353 18:5481617-5481639 GGGGTGGTGGTCCCATCTCCCGG - Intronic
1156379402 18:36544235-36544257 GGGGAGGTGGCACCAGCTCCCGG - Intronic
1157130049 18:44998285-44998307 GGGGTGGTAGCCCCGTTTCCGGG + Intronic
1159877505 18:73828744-73828766 GGGCTGCTGACCCCACTTCAGGG - Intergenic
1159904468 18:74077520-74077542 GGGCTGGTCGCTGCTGTTCCAGG - Intronic
1160006388 18:75072084-75072106 GCCCTGGTGGCCCCAGGGCCAGG - Intergenic
1160011216 18:75108254-75108276 GGGCTGGTGGTCCCTGGTGCAGG - Intergenic
1160691972 19:464328-464350 GGGCTGTAGGCCCCAGGGCCTGG + Exonic
1160973016 19:1778223-1778245 GTGCTTGTGGCCCCAGCTACTGG - Exonic
1161277173 19:3425015-3425037 ATGCTGGTGGCCCCAGTCCTGGG - Intronic
1161400758 19:4065606-4065628 GGGCGGGCGGACCCAGATCCGGG - Intronic
1162027826 19:7904273-7904295 GGGCTTGGGAGCCCAGTTCCCGG + Intronic
1162063566 19:8111242-8111264 GGGCAGGAGGCCCCAGTCACTGG + Intronic
1163604304 19:18265756-18265778 GCCCTGGGGACCCCAGTTCCCGG + Exonic
1163829879 19:19542482-19542504 TCGCTGGTGGCCACAGTGCCAGG - Exonic
1164188453 19:22893980-22894002 GGCCCGGCGGCCCCTGTTCCAGG + Intergenic
1165363645 19:35351321-35351343 GGACTGGGGGCCACAGGTCCTGG + Intergenic
1165850538 19:38847973-38847995 GGCCTGGCTGCCCCAGTTTCTGG - Intronic
1166682681 19:44778359-44778381 GGGGTGGGGGCCTAAGTTCCTGG - Intronic
1166682738 19:44778505-44778527 GGGGTGGGGGCCTGAGTTCCTGG - Intronic
1166682782 19:44778614-44778636 GGGGTGGGGGCCTGAGTTCCTGG - Intronic
1166682826 19:44778723-44778745 GGGATGGGGGCCTGAGTTCCTGG - Intronic
1166688467 19:44809495-44809517 GGGCTGGGGGCCCAGATTCCAGG - Intronic
1167258225 19:48443414-48443436 GGGCAGGTAGTCCCAGCTCCCGG - Exonic
1167291161 19:48625910-48625932 AGGCCCGTGGCCCCAGCTCCCGG - Exonic
1167427503 19:49436992-49437014 GGGCTGGGGGCCTGAATTCCCGG - Intronic
1168101450 19:54143599-54143621 GAGCTGTGGGCCCCAGTTCCTGG + Intronic
1168144985 19:54415709-54415731 GGGCTGGGGGCCGGAGCTCCTGG + Intronic
1168405091 19:56106568-56106590 GGCCGTCTGGCCCCAGTTCCTGG + Intronic
1202689927 1_KI270712v1_random:79268-79290 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
925056123 2:858698-858720 GGGCTGGAAGTCCCAGATCCAGG + Intergenic
925062369 2:902958-902980 GGGCTGGTGGCCAGAGACCCAGG - Intergenic
925897968 2:8487851-8487873 GGGCTGGTGGCTGCAGCTCGTGG - Intergenic
926051254 2:9746275-9746297 TGGCTGGTGTCCTCAGTTCCAGG + Intergenic
926718561 2:15942512-15942534 GGGCTGGCGGCGCCGGCTCCCGG - Exonic
927502556 2:23592248-23592270 AGGCTGGTGACCCCGGCTCCAGG + Intronic
928460126 2:31464554-31464576 GGGCTGATGGATCCACTTCCAGG + Intergenic
929012266 2:37456732-37456754 GGGCTGATGTGCCCACTTCCTGG + Intergenic
929190025 2:39131249-39131271 GGCCTGGTGGTCCCAGATACTGG - Intergenic
929571987 2:43028468-43028490 GGGCTGAGGGCCCCAGATCAGGG - Intergenic
930752727 2:54948508-54948530 GGGCGGGAGGCCACATTTCCTGG - Intronic
932434739 2:71696415-71696437 GGGCTGAAGGCCCCACTTCCAGG - Intergenic
932575768 2:72961589-72961611 AGGCTGTCGGCCCCTGTTCCTGG + Intronic
933902180 2:86857980-86858002 AGCCTGGTGGTCCCAGTGCCTGG + Intronic
933956491 2:87376755-87376777 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
933970212 2:87463891-87463913 GGGCTGGGGGCCTCAGGTGCAGG + Intergenic
934240637 2:90268781-90268803 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
934272555 2:91547978-91548000 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
934680834 2:96282918-96282940 GGTCTGGTGGCCAAAGGTCCTGG + Intronic
935778365 2:106491288-106491310 AGCCTGGTGGTCCCAGTGCCTGG - Intergenic
936323569 2:111486605-111486627 GGGCTGGGGGCCTCAGGTGCAGG - Intergenic
936524297 2:113232467-113232489 AGGCTGGTGGCCCCCAATCCAGG - Intronic
937020052 2:118642041-118642063 GGGCTGGAGGATCCAGTTCAAGG + Intergenic
939878614 2:147605131-147605153 TGGCTGGAGTCCTCAGTTCCTGG - Intergenic
944937427 2:204583940-204583962 GGCCTGCTTGCCCAAGTTCCTGG + Intronic
946454465 2:219813011-219813033 GGAGTGGTGACCCCAGTTCCAGG + Intergenic
947714994 2:232334896-232334918 GGGATGGTGGCTCCAGGCCCAGG + Intronic
947734070 2:232445847-232445869 GGGATGGTGGCTCCAGGCCCAGG + Intergenic
947874347 2:233458530-233458552 CAGCTCGTGGCCCCACTTCCTGG + Intronic
947970161 2:234316812-234316834 GTGCTAGTGGTCCCAGTTACAGG + Intergenic
948786478 2:240355461-240355483 GGGCAGGTGGCCCCAGCCCTGGG - Intergenic
948834654 2:240620238-240620260 GGGCAGGTGACCCCAGCCCCTGG - Intronic
1169254431 20:4086216-4086238 GGGCTCGTGTCTTCAGTTCCAGG + Intergenic
1170102974 20:12722494-12722516 GGTTTGGTGGACTCAGTTCCAGG + Intergenic
1170706279 20:18747360-18747382 AGGCTGCTGGGGCCAGTTCCAGG - Intronic
1171180469 20:23087357-23087379 GGGCTGCTGGAGCCAGTGCCAGG + Intergenic
1171415725 20:24979338-24979360 GGGACGGTGGCTCCAGTCCCAGG - Intronic
1172707628 20:36894027-36894049 TTGCAGGTGGCCCCAGCTCCTGG + Exonic
1174172298 20:48625274-48625296 GGGCTGGTGGCCCCAGTTCCAGG + Exonic
1174303706 20:49600467-49600489 GGGCTGATGGCACCACGTCCAGG + Intergenic
1174417179 20:50375151-50375173 TGGCAGGTGGCCCCAGGCCCTGG - Intergenic
1175899895 20:62355795-62355817 GGGCCAGTGGCCCCTGTGCCTGG + Intronic
1175965938 20:62660320-62660342 GGGCTGCTGGCCCCTCCTCCGGG - Intronic
1176055931 20:63149088-63149110 GGACTGGTGGTCTCAGTGCCAGG - Intergenic
1178303655 21:31472649-31472671 GGGCTGGTGGTGCCAGTATCTGG - Intronic
1178908269 21:36653928-36653950 GGGCGGGTGGCGGCAGTTTCAGG - Intergenic
1178953808 21:37006349-37006371 GAGCTCGTGGCCCCAATCCCTGG + Intronic
1179571821 21:42283007-42283029 CGGCTGGGGGCACCAGATCCAGG - Intronic
1180799454 22:18624973-18624995 GGGCGTGGGGCCCCAGTGCCCGG + Intergenic
1180833054 22:18915848-18915870 GGGCAGGGTGCCCCAGATCCAGG - Intronic
1181222264 22:21370293-21370315 GGGCGTGGGGCCCCAGTGCCCGG - Intergenic
1181638023 22:24183286-24183308 GGGCGTGGGGCCCCAGTGCCCGG - Intronic
1181695484 22:24590833-24590855 GAGCTTCTGGCCCCAGTGCCTGG - Intronic
1181853153 22:25764454-25764476 GGTCTGGTGGCCTCAGGGCCTGG + Intronic
1182682957 22:32096769-32096791 GGGCAGGTGGGCCAAGTCCCTGG + Intronic
1183314235 22:37128339-37128361 GGGCTGGGGGTCCCAGTCTCTGG + Exonic
1183459683 22:37942241-37942263 GAGTTGGTGGCGCCAGCTCCAGG - Exonic
1184456703 22:44614961-44614983 GGGCTGGTGGATTCAGGTCCTGG - Intergenic
1184456835 22:44615785-44615807 GGACTGGTGGATTCAGTTCCTGG - Intergenic
1184971442 22:48024377-48024399 GGGCTGGAGGACCTGGTTCCAGG - Intergenic
1185105323 22:48866013-48866035 TGTCTGGTGACCCCACTTCCCGG - Intergenic
1185162746 22:49239465-49239487 GGTGTGGTGGACCCAGGTCCTGG + Intergenic
1185339723 22:50285877-50285899 GGACAGCTGTCCCCAGTTCCTGG - Exonic
1203283138 22_KI270734v1_random:141152-141174 GGGCAGGGTGCCCCAGATCCAGG - Intergenic
950709855 3:14806298-14806320 GGGTTGTGTGCCCCAGTTCCTGG + Intergenic
951700978 3:25496560-25496582 TGGCTGGTGGCCCCAGCCTCAGG - Intronic
952347460 3:32502370-32502392 GGCTGGGTGGCCCCAGTTCGTGG + Intronic
953493430 3:43367884-43367906 TGGCTGGTACCCCCAGTACCTGG + Intronic
955071439 3:55575614-55575636 AGGGTGCTGGGCCCAGTTCCTGG + Intronic
955931139 3:64058037-64058059 TGGCAGGAGGCCTCAGTTCCTGG + Intergenic
956741699 3:72280566-72280588 GGGATGGTGGTCCCAGCTACTGG - Intergenic
956847063 3:73193328-73193350 ATGCTGGTGGCCCCAGGTCCCGG + Intergenic
957274018 3:78066795-78066817 GGGTTGGTGGATCCAGTTCTTGG - Intergenic
961333161 3:126154782-126154804 GAGCTGGTGCCCCTAGTTCTGGG + Intronic
961643296 3:128378716-128378738 TGGCTGCTGGCCCCAGCTGCAGG + Intronic
962711097 3:138086740-138086762 GGCCTGGAGGCCCCTGCTCCTGG + Intronic
962807718 3:138938962-138938984 GGCCTTGTAGCCCCTGTTCCGGG + Intergenic
966111588 3:176408858-176408880 GGCCTGGCAGCCCCTGTTCCAGG + Intergenic
968375046 4:32762-32784 GGGCTGGTGGCAGGAGTCCCTGG + Intergenic
968609541 4:1550852-1550874 GGGCTGGTGTCCCCAGAGGCAGG + Intergenic
968625001 4:1623079-1623101 GGGCTGGTGGCCACAGTGGGAGG - Intronic
968698693 4:2044667-2044689 GGGCTTGGGGCCCCAGGGCCAGG - Intergenic
968726722 4:2251306-2251328 GGCCTGGGTGCCCCAGTGCCTGG - Intronic
968789863 4:2652085-2652107 GGGCTGGTGGCCTCTGTGCCTGG + Intronic
968949182 4:3681645-3681667 GGGCTGGCAGCCCCTCTTCCTGG + Intergenic
969239489 4:5889277-5889299 GACCTGGTGGCCCCAGTGTCAGG - Intronic
969239525 4:5889419-5889441 GGGCTGGTGTCCACAGTGCTGGG - Intronic
969292056 4:6246213-6246235 GGGCTGTTAGCCCCATTTGCAGG + Intergenic
969398452 4:6938257-6938279 TGCCTGGTGGCCCCAGTGCTAGG + Intronic
969688506 4:8690294-8690316 GGGCTGCTGGCCCCCGTGTCTGG + Intergenic
980291581 4:130852315-130852337 TGGCTGTTGCCCCCACTTCCAGG - Intergenic
984367002 4:178812711-178812733 TGGCTGGTGGCCCCTCTGCCCGG + Intergenic
984756673 4:183331346-183331368 AGGCTGGGGGCCGCAGGTCCCGG - Intergenic
984920845 4:184762890-184762912 GGCCCGGTGGCCTCAGTTCCTGG - Intronic
985459997 4:190096282-190096304 GGGCTGGTGGCAGGAGTCCCTGG - Intergenic
985698544 5:1357109-1357131 AGGCTGGCGGTCCCAGATCCAGG + Intergenic
986279973 5:6314869-6314891 GGGCTGGTGTCCCCTCCTCCAGG - Intergenic
986480763 5:8184672-8184694 GGGCTGGTGGATGCAGTCCCTGG - Intergenic
988527656 5:32000838-32000860 GGGCAGGTGTCCCCAGCCCCTGG + Intronic
988576925 5:32435118-32435140 AGGCTGGTGACCTCAATTCCTGG + Intronic
989749496 5:44876204-44876226 GGCCTGGAGGCCACTGTTCCAGG - Intergenic
993589545 5:89777872-89777894 GTGCTGGTCGCCCCTCTTCCTGG - Intergenic
997658638 5:135573655-135573677 GGGGTGCTGGCACTAGTTCCTGG + Intronic
997669937 5:135662574-135662596 GGTCTGCTGGCCCCAGGCCCAGG - Intergenic
998176952 5:139907424-139907446 GGGATTGTGACCCCAGTTTCTGG + Intronic
998418410 5:141961898-141961920 GGGCTGGCTGCCCCACTTCCAGG + Intronic
999199307 5:149804764-149804786 GGGAAGGTGGCCCCAGGACCTGG + Intronic
1003498616 6:6686329-6686351 GGGCTGGAAGCCCCACATCCAGG + Intergenic
1005950351 6:30626942-30626964 GGGCTGGGGGCCTCAGGTGCTGG - Exonic
1007383408 6:41504522-41504544 GCGCGGGTGGGCTCAGTTCCCGG + Intergenic
1007779958 6:44246982-44247004 GGGCTGGTGGCGGCAGGTGCGGG + Intronic
1009382452 6:63049397-63049419 CAGCTCATGGCCCCAGTTCCTGG + Intergenic
1013304764 6:108838080-108838102 GAGCTCGTGGCCCCAGTTTCTGG - Intergenic
1016773220 6:147875537-147875559 GGGCTGGGGACCCCTGTTCTAGG - Intergenic
1017925923 6:158911792-158911814 GTGCTGGTGTCTGCAGTTCCTGG + Intergenic
1017953769 6:159161020-159161042 GGGCTGGAGGATCCACTTCCTGG - Intergenic
1018913296 6:168116698-168116720 GGGCTGCTGGGCCCAGTTGGGGG - Intergenic
1019302655 7:315792-315814 GGATTAGTGGCACCAGTTCCTGG - Intergenic
1023092894 7:36633020-36633042 AGGGTGGAGGCCCCAGCTCCGGG + Intronic
1023287732 7:38636754-38636776 GTGCTGGTGGCCACAGCTCCAGG - Intergenic
1025093399 7:56080908-56080930 GGGATCGTGGCCTCAGTTCCAGG + Exonic
1027539818 7:79453328-79453350 GGGCGAGTCGCCTCAGTTCCTGG + Exonic
1029439000 7:100577208-100577230 GGCTCGGTGGCCCCATTTCCAGG + Intronic
1030079225 7:105762929-105762951 TGGCTGGAGGCCTCAGTTCCTGG - Intronic
1031979441 7:128115334-128115356 GGTCTTGTGGACCCACTTCCAGG + Intergenic
1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG + Intergenic
1033244574 7:139707284-139707306 GGGCTTGTGGCCCTTGTTCCGGG - Intronic
1034296068 7:149973275-149973297 GGGCTGTTGGTGCCAGTGCCAGG - Intergenic
1034412516 7:150948635-150948657 GGGCTGGGCGCCCCAGCTCTGGG + Intronic
1034493047 7:151404547-151404569 GGGGTGGGGGCCTCAGCTCCAGG - Intronic
1034809963 7:154123534-154123556 GGGCTGTTGGTGCCAGTGCCAGG + Intronic
1035030178 7:155851903-155851925 GTGCTGGTGACTTCAGTTCCTGG - Intergenic
1035308278 7:157947454-157947476 GGATTGGTGGCCTAAGTTCCTGG + Intronic
1035708646 8:1696005-1696027 CAGCTGGGGGCCCCAGGTCCTGG + Intronic
1035850965 8:2919023-2919045 GGGAGGGGGGCTCCAGTTCCTGG + Intergenic
1036052980 8:5220951-5220973 GGCCAGGTAGCCCCAGGTCCTGG - Intergenic
1039010315 8:33086402-33086424 AAGGTGGTGGCCCCAGTCCCAGG + Intergenic
1039439803 8:37587208-37587230 GGGCTGGTGGTGCCCATTCCTGG - Intergenic
1039557354 8:38485988-38486010 GGTCTGCTGGACCCAGATCCTGG + Intergenic
1039621030 8:38997124-38997146 GGCCTGGTGGGCCCAGTCCTCGG + Exonic
1040080253 8:43276925-43276947 GGGCGGGTGGCCCCGTCTCCCGG + Intergenic
1047277409 8:123416590-123416612 GGGCAAGCGGCGCCAGTTCCTGG - Intergenic
1048989039 8:139750613-139750635 TGGCTTGTGGCCCCTGCTCCTGG + Intronic
1049212017 8:141391346-141391368 AGGCTTGTGGCTCCAGTTACTGG - Intergenic
1049436637 8:142589190-142589212 GGTCTGGTGGCCCCTTTGCCGGG - Intergenic
1049437838 8:142595829-142595851 GGGCTGCTGGCACCAGGACCGGG + Intergenic
1049615083 8:143572488-143572510 GGGACGGTGGCCCCACGTCCAGG + Exonic
1049625101 8:143616327-143616349 GGGAGGGTGGCCCCAGGGCCTGG + Intronic
1051542374 9:18234199-18234221 GGACTGGTGGTGCCAGTTACTGG + Intergenic
1051822091 9:21180644-21180666 CTGCTGGTGGCTGCAGTTCCAGG - Intergenic
1053290080 9:36873991-36874013 GGGGTGGGGGCCGCAGTACCAGG - Intronic
1056678369 9:88696146-88696168 GGACTGATGGCCTCAGTCCCTGG + Intergenic
1056759411 9:89404669-89404691 GGGATGGGGACCCCACTTCCTGG - Intronic
1056759455 9:89404813-89404835 GGGATGGGGACCCCACTTCCTGG - Intronic
1056759486 9:89404909-89404931 GGGATGGGGACCCCAATTCCTGG - Intronic
1056759516 9:89405005-89405027 GGGATGGGGACCCCACTTCCTGG - Intronic
1056759546 9:89405101-89405123 GGGATGGGGACCCCACTTCCTGG - Intronic
1056759564 9:89405149-89405171 GGGATGGGGACCCCACTTCCTGG - Intronic
1058128639 9:101224866-101224888 GGGCTGGTTCCTCCAGTTGCTGG + Intronic
1058819934 9:108720655-108720677 TGGCTTGGGCCCCCAGTTCCAGG - Intergenic
1059485991 9:114627111-114627133 GGGCTGTTGGCCCAGGTGCCTGG + Intronic
1060013951 9:120070114-120070136 GGGCTGGTGACCTTGGTTCCTGG - Intergenic
1061060099 9:128245989-128246011 GGTCTGGTGGCCCCCCTTCCTGG + Intronic
1061711122 9:132488725-132488747 GGGCTGGCAGCCCCAGCGCCCGG - Intronic
1062051193 9:134447947-134447969 GGGTTAGTGGCCCCAGGGCCAGG + Intergenic
1062142247 9:134966011-134966033 GGCCTGGTAGCACCAGATCCAGG - Intergenic
1062277322 9:135737060-135737082 GGGCAGGGGCCCCCAGTGCCTGG - Intronic
1062287764 9:135780711-135780733 GAGCTCCTGGCCCCAGTCCCCGG + Intronic
1062378368 9:136275155-136275177 GGGCTGTCGGCCCCACTTGCAGG - Intergenic
1062473149 9:136714958-136714980 GAGCTGGTGGCCCCATTTTAGGG + Intronic
1062550262 9:137082821-137082843 GGGCTGTAGCCCCCAGCTCCAGG - Exonic
1203770759 EBV:48896-48918 GGGCTGGCGGCCCCGAATCCGGG + Intergenic
1203574178 Un_KI270744v1:161388-161410 GGGCTGGTGGCAGGAGTCCCTGG - Intergenic
1185479554 X:435780-435802 GGAGCGGTGGCCCCAGGTCCCGG + Intergenic
1189319525 X:40079339-40079361 GGGTTGGAGGCACCAGGTCCGGG + Intronic
1191946881 X:66544212-66544234 AGGCTACTGACCCCAGTTCCTGG - Intergenic
1195102996 X:101574137-101574159 GGGCTGGCCCCCACAGTTCCAGG - Intergenic
1196497851 X:116343218-116343240 GGGCTCGTTCCCCCAGTTTCTGG - Intergenic
1198882718 X:141298566-141298588 GAGCTGGTGGCCCCAGGTGTGGG - Intergenic
1200211184 X:154347216-154347238 GGGCTGCTGGCCCCAGGCTCAGG - Intergenic
1200219668 X:154384876-154384898 GGGCTGCTGGCCCCAGGCTCAGG + Intergenic
1202366378 Y:24168580-24168602 GGGCTGGGGGACCCAGCTCCTGG - Intergenic
1202374128 Y:24218064-24218086 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1202496653 Y:25452056-25452078 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1202504403 Y:25501543-25501565 GGGCTGGGGGACCCAGCTCCTGG + Intergenic