ID: 1174173175

View in Genome Browser
Species Human (GRCh38)
Location 20:48629486-48629508
Sequence GGAGCTCTGCTACCGCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174173175_1174173183 -5 Left 1174173175 20:48629486-48629508 CCCCCAGGCGGTAGCAGAGCTCC 0: 1
1: 0
2: 0
3: 28
4: 143
Right 1174173183 20:48629504-48629526 GCTCCGAGGAGATGGGGATGAGG 0: 1
1: 0
2: 1
3: 34
4: 406
1174173175_1174173188 24 Left 1174173175 20:48629486-48629508 CCCCCAGGCGGTAGCAGAGCTCC 0: 1
1: 0
2: 0
3: 28
4: 143
Right 1174173188 20:48629533-48629555 CCCACACTCCCAGCAGCACCAGG 0: 1
1: 3
2: 6
3: 59
4: 571
1174173175_1174173190 30 Left 1174173175 20:48629486-48629508 CCCCCAGGCGGTAGCAGAGCTCC 0: 1
1: 0
2: 0
3: 28
4: 143
Right 1174173190 20:48629539-48629561 CTCCCAGCAGCACCAGGCTTTGG 0: 1
1: 1
2: 6
3: 33
4: 295
1174173175_1174173185 -1 Left 1174173175 20:48629486-48629508 CCCCCAGGCGGTAGCAGAGCTCC 0: 1
1: 0
2: 0
3: 28
4: 143
Right 1174173185 20:48629508-48629530 CGAGGAGATGGGGATGAGGCCGG 0: 1
1: 0
2: 3
3: 65
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174173175 Original CRISPR GGAGCTCTGCTACCGCCTGG GGG (reversed) Exonic
900867575 1:5279384-5279406 GGAGATCTGCTGCCTTCTGGAGG - Intergenic
901760535 1:11468475-11468497 GGAGCTCTGCTTCAGGCTGTAGG - Intergenic
902807310 1:18869152-18869174 GGAGCTCTGGGTCAGCCTGGTGG + Intronic
906107529 1:43303878-43303900 GGACCCCTGCTCCAGCCTGGGGG - Intronic
910344534 1:86220772-86220794 GGATCTCTGCTACCTTTTGGTGG - Intergenic
911841455 1:102687170-102687192 GGATCTCTGCTAACTCCAGGAGG + Intergenic
912489472 1:110054005-110054027 GGGGCTGTGCTGCCACCTGGTGG - Exonic
912752683 1:112298753-112298775 GGTGCTCTGCTGCCCCCTGGGGG - Intergenic
920440495 1:205977561-205977583 GGAGCACTGCTGCCCTCTGGTGG + Exonic
920933120 1:210407397-210407419 GGGGCACTGCTGCCCCCTGGTGG - Intronic
922570917 1:226634293-226634315 GGAGGCCTGCTGCCCCCTGGCGG - Exonic
922783066 1:228268777-228268799 GCAGCTCTCCTTCCGCCTGCAGG + Exonic
1067280144 10:44864993-44865015 GGGCCTCTGCTGCCCCCTGGCGG + Intergenic
1067435571 10:46273960-46273982 CCAGATCTGCTACCCCCTGGGGG - Intergenic
1069614944 10:69801252-69801274 CCAGCTCTGCTGCCCCCTGGAGG + Intergenic
1071573644 10:86711259-86711281 GGAGCCCTGACGCCGCCTGGCGG - Intronic
1073185667 10:101613798-101613820 GGAGCACTGCTGCTGCCAGGGGG + Intronic
1073190433 10:101646949-101646971 GGAGGTTTTCTATCGCCTGGCGG + Intronic
1073474687 10:103745164-103745186 GTATCTCTGTTACCACCTGGGGG + Intronic
1076923571 10:133468303-133468325 GGAGCTCTGCAACCCACTGCTGG - Intergenic
1077035667 11:493277-493299 GGAGCTCTGTTCCCCACTGGAGG + Intergenic
1081207762 11:40294251-40294273 GTGGCTCTGCTGCCACCTGGAGG + Intronic
1085027119 11:73242778-73242800 GCTGCTCTGCTTCCCCCTGGTGG + Intergenic
1085321206 11:75575086-75575108 GGAGCTTTCCTGCTGCCTGGAGG + Intergenic
1089073910 11:115721742-115721764 GGAGCTCTGCTTCCTGCTGGTGG - Intergenic
1089579863 11:119474877-119474899 GGAGCAATGCTACCTCCTAGTGG + Intergenic
1091211645 11:133865543-133865565 GGAGCTCTGCCTCCTTCTGGAGG + Intergenic
1091306245 11:134538100-134538122 TGAGCTCTGCAAACGTCTGGTGG + Intergenic
1091493143 12:949954-949976 GGATCTCTGCTGCCCCCTGGTGG + Intronic
1092160999 12:6315565-6315587 GGAGCTCTGCCACCAACAGGAGG + Exonic
1093012010 12:14117139-14117161 GGTGGTTTGCTACCGCCTAGCGG - Intergenic
1094419513 12:30255927-30255949 GGTGCTCTGCTTCAGCCTAGGGG - Intergenic
1094428596 12:30341716-30341738 GGTGCTCTGCTTCAGCCTAGGGG + Intergenic
1094495555 12:30987249-30987271 GGAGGTCTGGTCCCACCTGGAGG - Intronic
1099638751 12:85254378-85254400 GGAGCTCTGCTACTTCCTACTGG + Intronic
1101245867 12:102884076-102884098 GGAGCTGGGCTGCTGCCTGGAGG - Intronic
1102197115 12:111033884-111033906 GGAGCTCGGCGCCCGCCCGGGGG - Intergenic
1103715022 12:122940176-122940198 GGAGAACTTCTACCCCCTGGAGG - Exonic
1103999580 12:124852052-124852074 GGATCCCTGCTTCCTCCTGGAGG + Intronic
1104686342 12:130787481-130787503 GGAGCTCTGTGACGGCCTGGGGG - Intergenic
1113655960 13:112067895-112067917 GGAGATCAGCAAGCGCCTGGGGG + Exonic
1113850705 13:113416035-113416057 TCAGCTCTGCCGCCGCCTGGGGG - Intergenic
1121685408 14:95831794-95831816 GGAGCTCTGGGACAGCCTGGGGG + Intergenic
1122271425 14:100569990-100570012 GGAGCTTTGCTCCCGCATAGGGG - Intronic
1122959197 14:105086919-105086941 GGAGCTGCCCTGCCGCCTGGTGG + Intergenic
1123154503 14:106211185-106211207 GGAGGTGTGGTACGGCCTGGGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128313822 15:66647653-66647675 GGATGTCTGCTCCCGGCTGGCGG - Intronic
1128511550 15:68316656-68316678 GGAGCACTGCTGCCGCCTACTGG + Intronic
1129605813 15:77024461-77024483 GCAGCTCGGCTGCCCCCTGGCGG - Intronic
1132505160 16:304366-304388 GGAGCTCATCCACCGCCTGGAGG - Exonic
1132838918 16:1968790-1968812 GGAGCTCAGCAACTTCCTGGAGG + Exonic
1132871508 16:2117604-2117626 CGGGCACTGCTACCGCCTGGTGG - Exonic
1134521019 16:14919291-14919313 TGGGCACTGCTACCGCCTGGTGG + Intronic
1134550553 16:15136682-15136704 CGGGCACTGCTACCGCCTGGTGG - Intronic
1134708695 16:16317942-16317964 TGGGCACTGCTACCGCCTGGTGG + Intergenic
1134715908 16:16357975-16357997 CGGGCACTGCTACCGCCTGGTGG + Intergenic
1134950910 16:18350703-18350725 TGGGCACTGCTACCGCCTGGTGG - Intergenic
1134958848 16:18394184-18394206 CGGGCACTGCTACCGCCTGGTGG - Intergenic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1139382628 16:66543233-66543255 GAAGCTCTGCTCCAGCCTCGTGG - Intronic
1139692818 16:68651853-68651875 GGAGCTCTGCCTCCTTCTGGGGG + Intronic
1140478654 16:75251218-75251240 GGAACCCTCCTACCGGCTGGCGG + Intronic
1141569422 16:84925319-84925341 GGTGCTCTGCTGCCCCCTGGTGG - Intergenic
1141805529 16:86338952-86338974 GGAGCGCTGCCACCTCTTGGGGG - Intergenic
1141889584 16:86917792-86917814 GGAGCTCTGCTGTCTCCTCGGGG + Intergenic
1143608466 17:8003892-8003914 GGAGCAGCGCTACCTCCTGGAGG + Exonic
1144634533 17:16896717-16896739 GGAGGACTGCTACTGCCTGAAGG - Intergenic
1144703898 17:17355085-17355107 GGGGCTGTGCTGCCACCTGGTGG - Intergenic
1145168613 17:20636148-20636170 GGAGGACTGCTACTGCCTGAAGG - Intergenic
1145200565 17:20941238-20941260 GGAGGACTGCTACTGCCTGAAGG - Intergenic
1146164529 17:30577553-30577575 GGAGGACTGCTACTGCCTGAAGG - Intergenic
1146277143 17:31523145-31523167 GGAGCTGGGCTACCTCCTTGGGG + Intronic
1146648241 17:34589747-34589769 GGAGCCCTGCCACCGCATGACGG + Intronic
1148122071 17:45219074-45219096 GGATCTGTGCTACCCCCTGCTGG - Intergenic
1149580224 17:57744873-57744895 GGAGCACTGCAAGCGGCTGGAGG - Exonic
1150131501 17:62671701-62671723 GGGCCACTGCTACCGCCTGCAGG + Exonic
1151468195 17:74301334-74301356 GAAGCTCTGCTGCCCCCTGCTGG - Intronic
1152477063 17:80525434-80525456 GGAGCACTGCCTCCTCCTGGTGG - Intergenic
1152544147 17:80992285-80992307 GGGGCTCGGCCACAGCCTGGCGG + Intronic
1152630304 17:81408007-81408029 GGGGCTCTGCTCCCTCCTGCAGG - Intronic
1156276563 18:35589179-35589201 GGACCTCTACTCCCACCTGGTGG - Intronic
1157240317 18:46003297-46003319 GAGGCTCTGTTACCTCCTGGTGG + Intronic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1160492985 18:79353432-79353454 GCAGCTCTTCCACCCCCTGGTGG - Intronic
1160532218 18:79572120-79572142 GGTGCCCTGCTCCCGCCTGGTGG - Intergenic
1160815010 19:1031088-1031110 GGAGCTCTGCCTCCTTCTGGGGG - Exonic
1161441524 19:4294487-4294509 GCATCTGTGCTCCCGCCTGGGGG - Intronic
1162635412 19:11964054-11964076 GGGGCTCTGCTGCCCCCTGCAGG - Intronic
1163007597 19:14406333-14406355 GGGGCTGCGCTGCCGCCTGGTGG + Exonic
1163782699 19:19258637-19258659 GGAGCCCTGCGGCGGCCTGGGGG - Exonic
1164705630 19:30317352-30317374 GGGGCTCTCCTAATGCCTGGGGG - Intronic
1165154375 19:33778234-33778256 AGAGCGCTGCTGCCACCTGGCGG - Intergenic
1165406968 19:35636987-35637009 GGAGCTCTGCTGGCACCTGGAGG - Intronic
1165767507 19:38360485-38360507 GCAGATCTGGTACCTCCTGGAGG + Exonic
1165828899 19:38720784-38720806 GGATCTCCGCTACCACTTGGGGG + Intronic
1165902762 19:39176406-39176428 GGAGCTCCACCACCTCCTGGTGG - Intronic
1166667399 19:44689345-44689367 GGTGCTCTGCTGCCCCCTGCTGG - Intergenic
1167039287 19:47013137-47013159 GGCGCTCTGCTGACCCCTGGTGG - Intergenic
932403109 2:71495801-71495823 GGGGCTCTGCTACCCTCTGCAGG + Intronic
937247334 2:120502088-120502110 GCACCTCTGCTCCTGCCTGGCGG - Intergenic
943088900 2:183350715-183350737 ACAGCTCTGCCACAGCCTGGGGG - Intergenic
948945346 2:241216479-241216501 GGAGCTCTGCAACGGCCGCGGGG - Intronic
1171371444 20:24664885-24664907 GAATCTCTGCTACCCACTGGAGG - Intronic
1172330632 20:34073993-34074015 TCAGCTCTGCTACCGACTGGTGG - Intronic
1172629238 20:36367106-36367128 GGGGCTCTGCCACCGCCCGGGGG - Exonic
1173202742 20:40966224-40966246 GGAGCTCTGCTGTTACCTGGTGG - Intergenic
1173454796 20:43193137-43193159 GGTGCTCTGCTCCCCACTGGAGG - Intergenic
1174173175 20:48629486-48629508 GGAGCTCTGCTACCGCCTGGGGG - Exonic
1176119326 20:63446922-63446944 GGTGCCCTGCTGCGGCCTGGTGG - Intronic
1179305892 21:40153753-40153775 GGAGCACTGGTATCCCCTGGAGG - Intronic
1179976179 21:44868435-44868457 GGAGCCCTGCTTCCGGCTGATGG - Intronic
1180129918 21:45820732-45820754 GGACCTCTGCTGCCACCTCGTGG + Intronic
1180167614 21:46038122-46038144 GGAGCTGGGCTTCTGCCTGGAGG + Intergenic
1181312546 22:21952940-21952962 GGACCTCTGCTGCCCCCTGGCGG + Intergenic
1181422214 22:22810147-22810169 GCAGCTCTGCTGCCCCCTGCTGG - Intronic
1182397547 22:30047091-30047113 GGAGCTCTGCCTCCTTCTGGGGG + Intergenic
1183062470 22:35344627-35344649 TGGGCTCTGCTCCTGCCTGGGGG + Intronic
1183949490 22:41344727-41344749 GGAGCTCTGCTGTTTCCTGGGGG - Intronic
1183964428 22:41432898-41432920 GGAGCTCTGCTATCTCCCAGTGG - Intergenic
1184120111 22:42444569-42444591 GGAGATCTGGTGCCCCCTGGAGG + Intergenic
1184331223 22:43829099-43829121 GGAGCACTGCCACCAGCTGGTGG - Exonic
950816471 3:15708295-15708317 GGATTGCTGCTACTGCCTGGAGG - Intronic
952206139 3:31182577-31182599 GGAGCTCTGCCTCCTTCTGGGGG + Intergenic
953030773 3:39178283-39178305 GCAGCTCTGCCACAGGCTGGGGG + Intergenic
953849424 3:46454780-46454802 GGAGCTCAGCCTCCGCGTGGGGG + Intronic
954583382 3:51715582-51715604 GGAGCTCTGCTACATCCTGCTGG + Exonic
960876396 3:122300036-122300058 AGATATCTGCTACCACCTGGTGG + Intergenic
961347065 3:126270215-126270237 GGAGCTCTCCTTCCGGGTGGAGG + Intergenic
961648993 3:128408144-128408166 GGCGCTCTCCTCCTGCCTGGTGG - Exonic
964098444 3:152961401-152961423 GCATATCTGCTACCACCTGGTGG + Intergenic
968682475 4:1930619-1930641 GGTGCTCAGCTACCACCTGTGGG - Exonic
969613087 4:8237787-8237809 GGAGCGCTGCGCCCGGCTGGAGG + Intronic
971856339 4:32049019-32049041 TGAGCTGTGCTACCTCATGGAGG + Intergenic
978856936 4:113404234-113404256 GGAGGTCTGTTAACCCCTGGAGG + Intergenic
982235675 4:153249282-153249304 GCAGCTCGGCTCCCGCCTCGGGG + Intronic
984891572 4:184498739-184498761 GAAGCTGTGCTACTGCCTGGTGG - Intergenic
987435927 5:17894212-17894234 GAAGCTCTGCTACAGCATGGAGG + Intergenic
999573561 5:152947786-152947808 GGAGCTCTGCTGAAGCATGGGGG + Intergenic
1001282186 5:170394242-170394264 GAAGCTCTGCTTCCGCATGCTGG + Intronic
1002789189 6:425147-425169 GGAGCTCTGGAGCTGCCTGGCGG - Intergenic
1005116280 6:22341152-22341174 GGAGTTCTGCTACCAGCTGCTGG + Intergenic
1005813025 6:29530723-29530745 GGCTCTCTGCTCCAGCCTGGAGG + Intergenic
1018736408 6:166689992-166690014 GCAGCTCTGCCACCTCCTTGGGG - Intronic
1019303650 7:322272-322294 GGCGCTCTGCTGCCACCTGGTGG - Intergenic
1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG + Exonic
1020246831 7:6435797-6435819 GGGGCTCTGCTGCCCCCTGGCGG + Intronic
1020281710 7:6653333-6653355 GGAGCTGGGCAACGGCCTGGGGG + Exonic
1022339821 7:29457388-29457410 GGAGCTCTGAGACGGCCTGGGGG - Intronic
1024623984 7:51188540-51188562 GGGGCTCTGCTCCAGCCTTGTGG - Intronic
1026501411 7:70946315-70946337 GGAGATCTGCTGCCTTCTGGGGG + Intergenic
1028457377 7:91053321-91053343 TTGGCTCTGCTACAGCCTGGAGG - Intronic
1030689845 7:112520917-112520939 GGAACCCTGCTACCACCTGCAGG - Intergenic
1032727722 7:134606495-134606517 GGGGCTCTGCTGCCACCTAGTGG + Intergenic
1033228160 7:139576839-139576861 GGAGCTCTGCTGCCGAGTGGGGG + Intronic
1034465181 7:151223808-151223830 GGAGCTCTACGAGCGCCTGGAGG - Exonic
1035048539 7:155984643-155984665 GCAGCTCCCCTACCTCCTGGGGG + Intergenic
1035643562 8:1201332-1201354 GGAGCTCTGCTCCCGCTCAGGGG + Intergenic
1038540602 8:28386699-28386721 GGAGCTCGGCTGGGGCCTGGGGG + Intronic
1047958612 8:129994647-129994669 GGTGCCTTGCTACAGCCTGGCGG + Intronic
1048312741 8:133338299-133338321 GGAGCTCAGCTCCTGCTTGGTGG + Intergenic
1049473350 8:142785958-142785980 GGAGCTCTGCGACTGCCAAGAGG + Intronic
1052288853 9:26819675-26819697 GGAGCTCTGTTACCTTCTGTAGG - Intergenic
1052651443 9:31308196-31308218 GGAGCTCTGCTATAGTCTGTAGG - Intergenic
1059325466 9:113501612-113501634 GGAGCGCCGCTACCGCCAGGTGG + Intronic
1059368739 9:113807854-113807876 GAAGGTCTGCTCCAGCCTGGGGG + Intergenic
1060916888 9:127397273-127397295 GGAGCTCACCTGCCGCCAGGAGG - Exonic
1061169448 9:128943791-128943813 GGAGCTCTGCTCCCGGCTTCTGG + Intronic
1061839304 9:133348340-133348362 GGGGCTCTCCTAGCGCCAGGAGG - Intronic
1062297815 9:135842806-135842828 GGAGCTCTTGTAAGGCCTGGTGG - Intronic
1194217468 X:91148372-91148394 GGAGCTCTGCAACAGTCAGGTGG + Intergenic
1200553981 Y:4612164-4612186 GGAGCTCTGCAACAGTCAGGTGG + Intergenic