ID: 1174173994

View in Genome Browser
Species Human (GRCh38)
Location 20:48633668-48633690
Sequence AAGCAGGGGTTCTCAGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 487}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174173994_1174173998 9 Left 1174173994 20:48633668-48633690 CCACGCTCTGAGAACCCCTGCTT 0: 1
1: 0
2: 3
3: 69
4: 487
Right 1174173998 20:48633700-48633722 AGCCCAGAAGTTCCCAGCCCTGG 0: 1
1: 1
2: 7
3: 54
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174173994 Original CRISPR AAGCAGGGGTTCTCAGAGCG TGG (reversed) Intronic
900123330 1:1058853-1058875 AAGCTGGGGTTCCCTGAGTGGGG + Intergenic
900137139 1:1122400-1122422 GAGCAGGGGTTCTCAGGACCTGG + Intergenic
900481288 1:2900654-2900676 CAGCAGTGGTTCTCAGCTCGGGG + Intergenic
900513660 1:3071467-3071489 AAGGAGGGGTTCCCAGCGCTCGG - Intronic
900625386 1:3606176-3606198 ATGCAGTGGTTCTCAAAGTGGGG + Intronic
901233311 1:7653166-7653188 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
901676832 1:10890269-10890291 ACGCAGGGGATCTCGGAGGGAGG - Intergenic
902752408 1:18526236-18526258 AGGCAGTGGTTCTCAAAGTGTGG - Intergenic
903141006 1:21339118-21339140 GAGCTGGGGATCTCAGGGCGGGG + Intronic
904975227 1:34451068-34451090 AAGCAGTGGTTCTTAAAGTGTGG + Intergenic
906547708 1:46633020-46633042 AGGCAGTGGTTCTCAAAGTGTGG + Exonic
907360794 1:53912940-53912962 TAGCAGCGGTTCTCAAAGTGTGG - Intergenic
907700976 1:56787994-56788016 TAGCAGTGGTTCTCAAAGTGTGG + Intronic
907725104 1:57012964-57012986 AAGCAGTGGTTCTCAGTCTGGGG + Intronic
909449048 1:75778210-75778232 GAGCAGTGGTTCTCACAGCACGG + Intronic
910189863 1:84584371-84584393 TAGCAGGGGTTCTCAGAGTGTGG - Intergenic
910474135 1:87588941-87588963 AAGCAGTGTTTCTCAAAGTGTGG + Intergenic
910806575 1:91194335-91194357 AGGCAGTGGTTCTCAGAGTGTGG + Intergenic
911389266 1:97218450-97218472 ATACAGAGGTTCTCAGAGCTTGG + Intronic
911517154 1:98881106-98881128 AAGCAGTGGTTCTCCCAGCATGG - Intergenic
912992655 1:114504637-114504659 AAGCAGTGATTCTCAAAGTGTGG - Intronic
913461231 1:119087981-119088003 AATCAGGAATTCTAAGAGCGGGG + Intronic
914702927 1:150150325-150150347 GAGCGGGGGTCGTCAGAGCGCGG - Intronic
916856515 1:168755968-168755990 AAGGAGGTGATCTCAGAGGGTGG + Intergenic
917070253 1:171142572-171142594 GAGCAGTGGTTCTCAAAGTGTGG + Intronic
918106904 1:181423388-181423410 AAGCTGGGGTCCTGAGAGCCTGG + Intronic
920242713 1:204565068-204565090 CAGCAGTGGTTCTCAGAATGTGG - Intergenic
920495045 1:206448510-206448532 AAGCAGTGGTTTTCAAAGTGAGG + Intronic
920763635 1:208810139-208810161 GAGCAGTGGTTCTCAAAGTGTGG - Intergenic
920964357 1:210689910-210689932 ATCCAGGGGTTCTGAGAGCCTGG - Intronic
921713774 1:218398254-218398276 AAGCAGTGGTTCTTAAAGTGAGG - Intronic
921827739 1:219692836-219692858 GAGCAGTGGTTCTCAAAGCTTGG - Intronic
922032970 1:221822143-221822165 CAGCAGGGGTTCTCAAATTGTGG + Intergenic
922854536 1:228763280-228763302 AAGCATAGTTTCTCAGAGAGCGG - Intergenic
923221595 1:231899374-231899396 AGGCAGTGGTTCTCAGAATGTGG - Intronic
923327340 1:232892393-232892415 AAGAAGTGGTTCTCAGAACAAGG + Intergenic
923744233 1:236686214-236686236 AACCAGCCGCTCTCAGAGCGTGG + Intergenic
924098750 1:240582109-240582131 TAGCAGTGGTTCTCAAAGTGTGG - Intronic
924268882 1:242311475-242311497 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1063352578 10:5368917-5368939 GAGCAGCGGTTCTCAGAGTGTGG + Intronic
1063500885 10:6553209-6553231 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1064268349 10:13843301-13843323 AATCAGCGGTTCTCAAAGTGTGG - Intronic
1065387630 10:25148979-25149001 GAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1066223405 10:33357950-33357972 GAGCAGTGGTTCTCAAAGCATGG + Intergenic
1066716030 10:38287290-38287312 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1067209973 10:44251919-44251941 AAGCAGGGGTCCACAGAGAGCGG + Intergenic
1067509267 10:46881829-46881851 CAGCAGTGGTTCTCAGAGAAGGG - Intergenic
1067652985 10:48170026-48170048 CAGCAGTGGTTCTCAGAGAAGGG + Intronic
1068495386 10:57779471-57779493 AAGCAGTGGTTCTCTCAGCATGG + Intergenic
1069033125 10:63618647-63618669 AGGCAGTGGTTCTCAAAGTGTGG + Intronic
1069625158 10:69863293-69863315 GAGCAGGGGTTCTCAGCTCGGGG - Intronic
1069893727 10:71667735-71667757 AAGAAGGGGTTCTCAGGAAGGGG + Intronic
1069924871 10:71842080-71842102 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1070025693 10:72629429-72629451 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
1070804363 10:79262197-79262219 GAGCAGTGGTTCTCAAAGTGGGG + Intronic
1071836817 10:89426566-89426588 AAGCAGGGATTTTCAGGGCATGG - Intergenic
1072062924 10:91834667-91834689 AAGCAGTGTTTCTCAAAACGTGG - Intronic
1072766994 10:98103155-98103177 GAGCTGTGGTTCTCAGAGCATGG + Intergenic
1072775031 10:98182541-98182563 CAGCAGTGGTTCTCCGAGCACGG - Intronic
1072894127 10:99351013-99351035 AAGCAGTGGTTCTCAAATGGAGG - Intronic
1073694538 10:105849970-105849992 AAGCAGTGGTTCTCCCAGTGTGG + Intergenic
1074533644 10:114313396-114313418 CAGCATTGGTTCTCAGACCGAGG - Intronic
1075260449 10:120958831-120958853 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1075435856 10:122441005-122441027 AGGCAGTGGTTCTCAAAGTGTGG + Exonic
1075650034 10:124121702-124121724 AAGCAGGCTTCCTGAGAGCGTGG - Intergenic
1076414551 10:130276441-130276463 AAGCAGACATTCTCAGAGGGAGG + Intergenic
1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG + Intronic
1076640354 10:131911765-131911787 AAGCAGCAGTTCTCAAAGTGCGG - Intronic
1076890341 10:133280322-133280344 AAGCAGTGGTTCTCAATGCAGGG + Intronic
1077191500 11:1257671-1257693 CAGCAGGGGTTCTCGGCCCGGGG - Exonic
1078145622 11:8720156-8720178 AAGCAGTGGTTCTCAGTTGGGGG - Intronic
1078155374 11:8795372-8795394 AAGCAGTGGTTCTCAAAGTGGGG + Intronic
1078252213 11:9625563-9625585 AAGCAGTGGTTCTCAATGTGTGG - Intergenic
1078321655 11:10340237-10340259 GAGCAGTGGTTCTCCCAGCGTGG + Intronic
1078994078 11:16679100-16679122 GAGCAGTGGTTCTCCCAGCGTGG + Intronic
1079002549 11:16770122-16770144 AAGCTCGGGTTCTCAGAGCAGGG + Intergenic
1079353196 11:19710620-19710642 ATGCAGTGGTTCTCAAAGTGTGG - Intronic
1080830747 11:35891195-35891217 AAGCAGGGGTTGGCGGAGGGTGG - Intergenic
1081371886 11:42314180-42314202 AAGAAAGGGTTCTCAGTGCCTGG - Intergenic
1081684253 11:45030456-45030478 AAACAGTGGTTCTCAAAGTGAGG + Intergenic
1082878904 11:58018490-58018512 AAGGAGTGGTTCTCAAAGTGTGG - Intergenic
1082980544 11:59116681-59116703 AGTCAGGGGTTCTCAAAGCCTGG + Intronic
1084278100 11:68066719-68066741 GAGCAGGGGTTCTCATGGCCAGG - Intronic
1085316360 11:75547647-75547669 CAGCAGTGGTTCTCAGAGTGTGG - Intergenic
1086899024 11:92345423-92345445 GAGCAGTGGTTCTCAAAGTGGGG + Intergenic
1087140372 11:94759906-94759928 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1087240104 11:95765032-95765054 AAGCAGGGGTTCTCAACCCTCGG + Intergenic
1088691322 11:112331103-112331125 AAGCAGTGGTTCTCTCAGCACGG - Intergenic
1089533288 11:119145645-119145667 AAGCAATGGTTCTCAGAAGGTGG + Intergenic
1089814945 11:121164487-121164509 AATTAGTGGTTCTCAGACCGAGG + Intronic
1090035380 11:123245457-123245479 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
1090078181 11:123592574-123592596 AAGCTGGGGTTTTCAGTGTGTGG + Intronic
1091105856 11:132919263-132919285 AGACAGTGGTTCTCAGAGAGGGG + Intronic
1091643929 12:2259133-2259155 AAGCAGTGGTTCTCAGAATATGG + Intronic
1091795150 12:3293826-3293848 AAGCAGTGGTTCTTAAAGTGTGG + Intergenic
1091847417 12:3668308-3668330 AAGCAGCATTTCTCAGAGTGTGG + Intronic
1092424514 12:8363614-8363636 AAGCAGCAGTTCTCAGATGGGGG + Intergenic
1092941933 12:13418007-13418029 AGGCAGGGTTTCTCAGAGTGAGG - Intergenic
1093793216 12:23279496-23279518 AAGCAGCGTTTCTCAAAGTGCGG - Intergenic
1094059085 12:26294345-26294367 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1094497226 12:30995894-30995916 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
1095091714 12:38113696-38113718 AGGCAGGAATTCTCAAAGCGAGG - Intergenic
1095647483 12:44564951-44564973 CAGCAGTGGTTCTCACAGTGTGG + Intronic
1096075395 12:48800738-48800760 AAGAAGGGGTCCTCAAAGAGGGG - Intergenic
1096251381 12:50035138-50035160 AAGCAGGGCTCCCCAGAGCCTGG - Intergenic
1098284174 12:68891582-68891604 AGGCAGAGGTTCTCAAAGTGTGG + Intronic
1098674631 12:73273357-73273379 AAGCAGTGGTTCTCAATGTGTGG + Intergenic
1098691124 12:73489159-73489181 AAGCTGGGGTGCTCAGTGTGTGG - Intergenic
1099177225 12:79435917-79435939 AAGCAGGGGTTCTCAGCGGGGGG - Intronic
1099440676 12:82695824-82695846 AAGAAGGGGTTCTCAAAGTGGGG + Intronic
1100903033 12:99265171-99265193 TAGCAGTGGTTCTCATAGTGTGG + Intronic
1101759195 12:107645319-107645341 CAGCAGTGGTTCTCAGAGACAGG - Intronic
1101797046 12:107984749-107984771 CAGCAGTGGTTCTCATAGTGAGG + Intergenic
1102420555 12:112799934-112799956 GAGCAGGGGTTCTCACAGTGTGG - Intronic
1102992365 12:117324296-117324318 AGGGAGGGGTTATCAGAGCAGGG + Intronic
1103839322 12:123849977-123849999 AAGCTGTGTTTCTCAGAGCCAGG + Intronic
1103900775 12:124302743-124302765 CAGCAGGGGTTCTCACCGCCAGG + Intronic
1104058623 12:125249353-125249375 ACTCGGTGGTTCTCAGAGCGTGG - Intronic
1105736956 13:23281495-23281517 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1106453267 13:29903852-29903874 AAGCAGTGGTTCTGAAAGCATGG - Intergenic
1106633700 13:31504728-31504750 GAGCAGCGGTTCTCAAAGTGTGG - Intergenic
1107080651 13:36371097-36371119 AAGCAGTGGTTTTCAAAGTGTGG - Intergenic
1107457237 13:40566152-40566174 CAGCAGGGGTTGGCAGAGCAGGG + Intronic
1108048023 13:46401748-46401770 AAGCATGGGGGCTCAGAGCATGG - Intronic
1108170374 13:47735401-47735423 GAGCAGTGGTTCTCCCAGCGTGG + Intergenic
1108519226 13:51230909-51230931 AAGCAGAGGATCCCAGCGCGAGG - Intronic
1109417058 13:62054035-62054057 AAGAAGTGGTTCTCAAAGTGTGG + Intergenic
1109438688 13:62340848-62340870 AAACAGTGGTTGTCAGAGCCTGG - Intergenic
1110826371 13:79975663-79975685 GAGCAGTGGTTCTCACAGCATGG + Intergenic
1112437716 13:99403540-99403562 GAGCAGTGGTTCTCAGACTGTGG - Intergenic
1113348749 13:109507808-109507830 GAGCAGTGGTTCTCCCAGCGTGG - Intergenic
1113774398 13:112934591-112934613 AACCAGTGGTTCTCAAAGTGGGG - Intronic
1117688080 14:58276474-58276496 AAGCAGTGGTTCTCAGGGTGGGG + Intronic
1117803408 14:59466417-59466439 AAGCAGTGGTTCACAGAGTATGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118943790 14:70363324-70363346 GAGCAGTGGTTGTCAGAGTGTGG - Intronic
1118951535 14:70440306-70440328 AAGCAGGTTTTCACAGAGTGTGG + Intergenic
1119033116 14:71207854-71207876 GACCAGGGGTCCTCAGACCGTGG - Intergenic
1119071611 14:71590985-71591007 AAGCAGGGGTTCTCAGCTAGGGG - Intronic
1121219352 14:92274330-92274352 CTGCAGGGGTTCTCACAGCCCGG + Intergenic
1121331614 14:93053166-93053188 AACCAGTGGTTCTCAGACAGAGG + Intronic
1121449739 14:93999487-93999509 AAGCAGGAGATCACAGAGGGTGG + Intergenic
1121521199 14:94587313-94587335 AAGAAGGTGTCCTCAGAGAGGGG - Intronic
1121605361 14:95236421-95236443 AACCAGTGGTTCTCAGCCCGGGG + Intronic
1122445943 14:101768755-101768777 AAAGAGGGGTTCTCAAAGTGTGG - Intronic
1122487059 14:102088447-102088469 GAGCAGGGGTTTTCAGACTGCGG + Intronic
1125313986 15:38411259-38411281 AAGCAATGGTTCTCAAAGTGTGG - Intergenic
1125998653 15:44188627-44188649 AAGCAGTGGTTCTCAAAGTATGG - Intronic
1126866392 15:52941703-52941725 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1127424530 15:58842006-58842028 AAGCAGAAGTTATCAGAGGGTGG - Intronic
1127440004 15:58997256-58997278 GAGTAGTGGTTCTCAGAGTGTGG + Intronic
1127488203 15:59438290-59438312 CGGCCGGGGTTCCCAGAGCGCGG - Intronic
1127876240 15:63114031-63114053 TGGCAGGGGTTCTCACAGTGTGG - Intergenic
1127918381 15:63473964-63473986 GAGCAGTGGTTCTCAGAGCAAGG - Intergenic
1127961685 15:63895141-63895163 GATCAGGGGTTCTCAAAGTGTGG - Intergenic
1128512607 15:68322574-68322596 AAGCAGGGGTTGGCTGGGCGTGG + Intronic
1128616985 15:69117989-69118011 GAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1128780320 15:70354787-70354809 AGGCAGAGGTTCTCAAAGTGTGG + Intergenic
1128932620 15:71718829-71718851 ATGCAGAGGCTCTCAGAGAGCGG - Intronic
1129407395 15:75328523-75328545 GAGCTGGGGTTCCCAGAGCCTGG + Intergenic
1129470571 15:75751314-75751336 GAGCTGGGGTGCTCAGAGCCTGG + Intergenic
1129871518 15:78944702-78944724 AGGCGGGGGTTCTCGGAGGGTGG - Intronic
1129914780 15:79259225-79259247 AGGCAGTGGTTCTCAAAGTGTGG + Intergenic
1131374357 15:91911324-91911346 AAGCAGAGGTACTCAAAGTGGGG + Intronic
1132006603 15:98233163-98233185 AAGCAGTGGTTCTCAAAGTATGG + Intergenic
1132150356 15:99454351-99454373 CTCCAGGGGTTCTCAGAGTGTGG - Intergenic
1132237982 15:100236332-100236354 AGGCAGGGCTTCTCAGAGTGTGG + Intronic
1132296240 15:100736819-100736841 GGGCAGTGGATCTCAGAGCGTGG - Intergenic
1132851858 16:2028409-2028431 AAGCAGGTGTTCCCAGGGCGAGG - Intronic
1134746883 16:16595373-16595395 AAGCAGGGATTTGCAGAGTGAGG + Intergenic
1134793190 16:17009741-17009763 GAGCAGTGGTTCTCACAGCATGG - Intergenic
1134914939 16:18061591-18061613 CAGCAGTGGTTCTCAAAGCGTGG + Intergenic
1134998591 16:18758290-18758312 AAGCAGGGATTTGCAGAGTGAGG - Intergenic
1135078644 16:19415336-19415358 GAGCAGTGGTTCTCAGGGGGAGG + Intronic
1135139848 16:19912039-19912061 AGCCAGTGTTTCTCAGAGCGTGG - Intergenic
1136291303 16:29273211-29273233 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1136490970 16:30608207-30608229 CAGCAGTGGTTCTCAAAGCGTGG - Intronic
1137261034 16:46830668-46830690 CAGGAGGGGTTCTCGGAGCTAGG + Intronic
1137270624 16:46900340-46900362 AATCAGGGGTTTGCAGAGCAGGG - Intronic
1137324951 16:47424940-47424962 GAGCAGTGGTTCTCTCAGCGTGG - Intronic
1138220517 16:55246418-55246440 AAGCAGTGGTTTTCAAAGTGTGG + Intergenic
1138911174 16:61401054-61401076 AAACAGTGGTTCTCAAAGTGCGG + Intergenic
1139818837 16:69702521-69702543 AACCAGTGGTTCTCAGAGTATGG + Intronic
1140715362 16:77721529-77721551 AAGCAGTAGTTCTCAAAGTGTGG - Intergenic
1140820456 16:78658198-78658220 AAGCAGGGGTTCTCATCCAGGGG - Intronic
1140824791 16:78695889-78695911 GACCAGGGGTTCTCAAAGTGGGG + Intronic
1141443427 16:84043542-84043564 AAGCAGTGCTTCTCAGCGAGGGG - Intergenic
1141775024 16:86117380-86117402 GAGCAGAGGTTCCCAGAGTGAGG + Intergenic
1142097170 16:88246677-88246699 AAGCGGTGGTTCTCAAAGTGTGG - Intergenic
1143117914 17:4591074-4591096 AAGGAGGGCTTCTCAGAGGCAGG - Intronic
1143492325 17:7291718-7291740 GTGCAGTGGTTCTCAAAGCGTGG - Intronic
1144040691 17:11408273-11408295 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144412234 17:15012445-15012467 GAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1144814536 17:18024840-18024862 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144948993 17:18984037-18984059 AGGCAGGGGTTCTCAAACGGGGG - Intronic
1145861250 17:28212195-28212217 AAGCAGTGGTTCTCCCAGCATGG + Intergenic
1146477219 17:33172713-33172735 ATGCAGTGGTTCTCAAAGTGTGG + Intronic
1147494469 17:40902812-40902834 AAGCGAGGGTTCTCAAAGTGTGG + Intergenic
1147550199 17:41436358-41436380 AAGCAGGAGCTCTCAGAGGAAGG + Intergenic
1148037754 17:44680912-44680934 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1149401239 17:56297998-56298020 GAGCAGTGGATCTCAGAGTGCGG + Intronic
1149543091 17:57483510-57483532 CAGCAGTGGTTCTCAAAGCGTGG - Intronic
1149636581 17:58175460-58175482 CAGCATGGGTTGTCAGAGCCTGG - Intergenic
1149867489 17:60158768-60158790 AAACAGTGGTTCTCAAAGTGCGG + Intronic
1149932016 17:60766699-60766721 GAGCAGTGGTTCTCACAGCATGG - Intronic
1151011610 17:70504473-70504495 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1151269677 17:72984516-72984538 AAGCAGCTGTTCTCAAAGTGGGG + Intronic
1151322687 17:73361243-73361265 AGGCAGCGGTTCTCAGAGCAGGG - Intronic
1151461775 17:74258623-74258645 GAGCAGTGGTTCTCCAAGCGTGG - Intronic
1152056330 17:78030739-78030761 GAGCAGTGGTTCTCATAGAGAGG + Intronic
1152149544 17:78590299-78590321 GAGCGGAGGTTCTCAGAGTGGGG + Intergenic
1152274593 17:79348926-79348948 GAGCAGGGTTTCTCGGAGAGTGG - Intronic
1152935901 17:83136488-83136510 AGGCCGGGGGTCTCAGAGCTGGG + Intergenic
1154351489 18:13587259-13587281 GGGCAGGGGTTCTCAAAGTGTGG - Intronic
1155518487 18:26645755-26645777 AAACAGAGGTTCTCAAAGTGCGG + Intronic
1155968436 18:32057944-32057966 AAGCAATGGTTCTCAGCGTGGGG - Intronic
1156436516 18:37136115-37136137 AAGCAGTGGTTCTTAAAGTGTGG - Intronic
1157409600 18:47452716-47452738 ATGCAGAGGTTCCCAGACCGTGG + Intergenic
1157558904 18:48632473-48632495 AAGCAGTGGATCTCAGAGTGTGG - Intronic
1158188776 18:54801760-54801782 AGGCAGTGGTTCTCACAGTGAGG - Intronic
1158410590 18:57201925-57201947 TAGCAATGGTTCTCAAAGCGTGG - Intergenic
1158677504 18:59534550-59534572 AAGCAGTGATTCTCACAGTGTGG + Intronic
1158842746 18:61405666-61405688 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1158902007 18:61972768-61972790 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1159011559 18:63063214-63063236 CAGCAGCAGTTCTCAAAGCGTGG + Intergenic
1160296030 18:77637724-77637746 AAGCAGTGGTTCTCCAAGCATGG + Intergenic
1161871637 19:6875063-6875085 AATCAGGGTTTCTAAGAGGGAGG - Intergenic
1161951201 19:7469100-7469122 GAGCAGGGGCTCTCAGCGCTGGG + Exonic
1162373214 19:10290983-10291005 AGTCAAGGGTTCTCAGAGGGCGG - Intronic
1162672179 19:12266501-12266523 AATTAGGGGTTCTGAGGGCGGGG - Intronic
1163270686 19:16251691-16251713 AAGGAGGGGTCATCAGAGCTGGG - Intergenic
1163699703 19:18781128-18781150 ACGCAGGGGCTCTCAGAGCAAGG + Exonic
1164562571 19:29302851-29302873 ACACAGGGGCTCTCAGCGCGTGG + Intergenic
1164906858 19:31974877-31974899 AAGGAGGGTTTCTCAGGGAGGGG + Intergenic
1165089581 19:33376602-33376624 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
1166041956 19:40208959-40208981 ATGCAGTGGTTCTCAGAGTGTGG - Intronic
1166357389 19:42235235-42235257 AAGCAGTGGTTCTCAGAGTGTGG - Intronic
1166375373 19:42324516-42324538 GGGCAGGGGTGCTCAGACCGGGG - Intronic
1166548514 19:43649257-43649279 AAGCAGCAGTTCTCAGGGCCAGG + Intronic
1166962037 19:46502919-46502941 GAGCAAGGGTTCTCAAAGTGTGG + Intronic
1167332343 19:48864054-48864076 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
1168710917 19:58499464-58499486 AGGCAGGGTTTCTCGGGGCGGGG - Intronic
925774528 2:7321263-7321285 AAGCAGTGGTTCTCAAAGAGAGG - Intergenic
925858554 2:8153276-8153298 AAGCAGGGGAAGTCAGAGCTAGG + Intergenic
926054693 2:9767765-9767787 AAGCAGAGCTTCTCAGATCTCGG - Intergenic
926074705 2:9932675-9932697 AAGCAGTGGTTCTCACAGCATGG - Intronic
926665682 2:15519800-15519822 AAGCAGTGGTTCTCAAAATGTGG - Intronic
926995443 2:18730259-18730281 AAGCAGGGGTCCTCAAACCCTGG + Intergenic
928322392 2:30294308-30294330 CATCAGGGGTTCTCAGAATGTGG + Intronic
928946453 2:36776209-36776231 AACCAGTGGTTCTCAAAGTGTGG + Intronic
929250260 2:39746299-39746321 TAGCAGTGGTTCTCAAAGTGTGG + Intronic
929866572 2:45722489-45722511 AAGCAGTGGTTCCCAAAGTGTGG - Intronic
929939542 2:46322592-46322614 AAGCAGTGGTTCTCATAGTGTGG - Intronic
929966231 2:46539303-46539325 AAGCAGTGGTTCTGGGAGCGAGG - Intronic
930356149 2:50323354-50323376 AAGCAGTGGTTCTCAAAATGTGG - Intronic
930795888 2:55390351-55390373 AAGCAGTGGTTCTCAGAGTATGG - Intronic
931923149 2:67042915-67042937 AAGCACTGGTTCTCAAAGTGTGG + Intergenic
932414031 2:71563152-71563174 TACCAGGGGTTCTCAAAGTGTGG - Intronic
932475396 2:72002850-72002872 GAGAAGTGGTTCACAGAGCGAGG - Intergenic
932554014 2:72802788-72802810 CAGCAGTGGTTCTCAAAGTGTGG + Intronic
934476842 2:94599308-94599330 AAGCAGGGGAGCCCAGAGCTGGG - Intronic
935050212 2:99518807-99518829 AAGCAGTGGTTCTCAATGTGGGG + Intergenic
936775306 2:115965522-115965544 GAGCAGTGGTTCTCACAGCATGG - Intergenic
936976974 2:118230276-118230298 GAGCAGCAGTTCTCAGAGTGTGG + Intergenic
937438236 2:121896628-121896650 GAGCAGGGGTTCTCAAAGTGGGG + Intergenic
938242680 2:129755515-129755537 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
938380719 2:130835124-130835146 AACCAGGGGTTCTCTAAGTGTGG + Intergenic
938784237 2:134610531-134610553 AAGCAGGGTTTCTCAAGGTGTGG - Intronic
939985919 2:148829827-148829849 CAGCAGGGGCTCTCAGGGGGAGG + Intergenic
940130813 2:150379549-150379571 AAGCAGAGGTTCTCAAAGTGTGG + Intergenic
941432189 2:165426479-165426501 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
941850268 2:170173282-170173304 AAGCAGTGTTTCTCAAAGGGTGG + Intergenic
942263663 2:174198432-174198454 AAGCAGGGGTTCTTAAAGTATGG + Intronic
944432308 2:199646531-199646553 GAACAGGGGTTCTCAGAGTGTGG - Intergenic
944503244 2:200383183-200383205 GAGCAGGGGTTCTTAAAGTGTGG - Intronic
944675937 2:202034216-202034238 CGGCAGGGGTTCTCCTAGCGGGG + Intergenic
944747754 2:202675481-202675503 AAGCAGAGGTTTTCTGAGAGAGG - Intronic
945716073 2:213359279-213359301 AAGCAGTGGTTCTCCCAGCATGG - Intronic
945794244 2:214342220-214342242 AAGCAGGGGTTCCCAAAGCAGGG + Intronic
946505651 2:220297902-220297924 AAGCAATGGTTCTCAAAGTGCGG + Intergenic
946571437 2:221028367-221028389 AAGCAGCTGGTCTCAGAGAGTGG - Intergenic
946869190 2:224070748-224070770 AAGCAGGGTTGATCAGAGGGAGG + Intergenic
947089748 2:226496629-226496651 TGGCAGGGATCCTCAGAGCGAGG - Intergenic
947494032 2:230619884-230619906 AAGCAGTGGTTCTCACAGCATGG + Intergenic
947742949 2:232493141-232493163 GAGCAGGGGTGCCCAGAGCCTGG + Intergenic
948546191 2:238730463-238730485 ACACAGCGGTTCTCAGAGTGGGG + Intergenic
948835869 2:240625704-240625726 TGACGGGGGTTCTCAGAGCGAGG + Intronic
948950695 2:241249360-241249382 AAGCAAGGGTGCTCACAGCTTGG + Intronic
1169294163 20:4378345-4378367 AAGCAGTGGTTCCCAAAGTGTGG - Intergenic
1170142082 20:13134517-13134539 CAGCAGTGGTTCTCAAAGAGTGG + Intronic
1170284564 20:14692087-14692109 GAGCAGTGGTTCTCAAAACGTGG + Intronic
1170816159 20:19716186-19716208 GAGCAGTGGTTCTCAGAGGGTGG - Intronic
1170905784 20:20514390-20514412 AAGCAGGAGCTCTCAGTGCCTGG - Intronic
1171050530 20:21854055-21854077 GAGCAGTGGTTCTCACAGCATGG + Intergenic
1171178694 20:23075267-23075289 AAGCAGCGGTTCTCCAAGGGCGG + Intergenic
1171353797 20:24527733-24527755 GAACAGTGGTTCTCAGAGTGTGG + Intronic
1172667618 20:36611628-36611650 AAGCAGGGATTCTCAAACCTTGG - Intronic
1173033226 20:39381531-39381553 AAGCAGTGGTTCTCTAAGTGTGG - Intergenic
1173299715 20:41791244-41791266 AAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1174043563 20:47717196-47717218 AACCAGTGGCTCTCAAAGCGTGG - Intronic
1174173994 20:48633668-48633690 AAGCAGGGGTTCTCAGAGCGTGG - Intronic
1174471522 20:50764722-50764744 AATTAGGGGTTCTCAGAACACGG + Intergenic
1175531834 20:59678852-59678874 AAGCAGTGGTTCTCACATCTTGG + Intronic
1175578033 20:60077450-60077472 GAGCAGTGGTTCTCTGAGTGTGG - Intergenic
1175665066 20:60851814-60851836 AACTGGGGGTTCTCTGAGCGTGG + Intergenic
1175896979 20:62341576-62341598 AAGCAGTGGTTCTCAGCCAGTGG - Intronic
1176014205 20:62920607-62920629 GAGAAGTGGTTCTCAAAGCGTGG + Intronic
1176425836 21:6547707-6547729 AAGCAGGCGCTCTCAGAGCCAGG - Intergenic
1178259011 21:31081537-31081559 CAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1178385565 21:32146317-32146339 AAGCAGTGTTTGTCAGAGCGTGG + Intergenic
1179377469 21:40863479-40863501 GAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1179539767 21:42076510-42076532 CAGCAGAGGTTCTCAAAGTGGGG - Intronic
1179701327 21:43156024-43156046 AAGCAGGCGCTCTCAGAGCCAGG - Intergenic
1180611208 22:17099399-17099421 AAGCAGTGGGTCTCAAAGTGTGG + Intronic
1181856789 22:25787432-25787454 CAACAGTGGTTCTCAAAGCGGGG - Intronic
1181972096 22:26698628-26698650 AAGCAGGGACTCTGAGAGCAGGG + Intergenic
1182013668 22:27021343-27021365 GAGCAGCTGTTCTCAAAGCGTGG + Intergenic
1182494544 22:30696519-30696541 AAACAGTGCTTCTCAGAGTGTGG - Intronic
1183681903 22:39336107-39336129 AAGCACCAGTTCTCAGAGTGTGG + Intergenic
1183828125 22:40404393-40404415 GAGCGGAGCTTCTCAGAGCGGGG - Exonic
1184621755 22:45684390-45684412 AAGCAGGGGTTGCCAGACCATGG + Intronic
1184771806 22:46601386-46601408 AACCAGAGGTTCTCAAAGTGTGG - Intronic
1184920356 22:47601194-47601216 AGGCAGTGGTGCTCAGAGCCAGG - Intergenic
949325437 3:2858170-2858192 AAACAGTGTTTCTCAGAGTGTGG + Intronic
949388276 3:3530078-3530100 TAACAGTGGTTCTCAAAGCGTGG + Intergenic
949744274 3:7270143-7270165 AAGCATTGGTTCTCAAAGTGTGG - Intronic
949748644 3:7325514-7325536 AAGCAGAGGTTCTCAAAGTGTGG - Intronic
949750138 3:7342752-7342774 CAGCAGCGGTTCTCAAAGTGTGG - Intronic
949790756 3:7789569-7789591 GAACAGTGGTTCTCAAAGCGTGG - Intergenic
950171676 3:10843169-10843191 AAGCGTGGGTTCTGAGAGCCAGG + Intronic
950497151 3:13340612-13340634 GAGCAGCGGTTCTCAGTGTGTGG + Intronic
950758945 3:15203228-15203250 GAGCAGTGGTTCTCAAAGTGTGG + Intergenic
950771119 3:15312005-15312027 CACCAGTGGTTCTCAGAGCGTGG + Intronic
950866661 3:16195253-16195275 GAGCAGAGGTTCTCAAAGTGTGG + Intronic
950866889 3:16196735-16196757 GAGCAGAGGTTCTCAGAGTGTGG - Intronic
950982316 3:17320250-17320272 AAGCAGTGGTTTTCAAAGTGTGG + Intronic
952164130 3:30727882-30727904 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
952586304 3:34896764-34896786 AAGCAGGGCTACTCAAAGTGTGG + Intergenic
952716997 3:36489868-36489890 AATCAGTGGTTCTCAGTGTGTGG + Intronic
952846841 3:37695014-37695036 AGGCAGGGTCCCTCAGAGCGTGG + Intronic
953608787 3:44429937-44429959 AAACAGGAATTCTCAGAGTGAGG + Intergenic
953821340 3:46209922-46209944 GAGCAGTGGTTCTCAAAGTGAGG + Intronic
953856601 3:46504018-46504040 AAACATGGGTTCTCAGGGAGTGG + Intergenic
953877030 3:46672242-46672264 AAGGAGGGGATGTCAGAGCTGGG - Intronic
956601555 3:71028337-71028359 AGGCAGTGGTTCTCAGAGTACGG + Intronic
958075016 3:88665454-88665476 AGGGAAGGGTGCTCAGAGCGTGG + Intergenic
958645439 3:96865776-96865798 AAGCATTGTTTCTCAGAGTGAGG + Intronic
958805965 3:98810270-98810292 AATCAAGGGTTCTCAGAGGCAGG - Intronic
959623277 3:108421985-108422007 TAGCATGAGTTCTCAGAGTGTGG - Intronic
959826508 3:110803427-110803449 AAGTAGGTGTTCTCAGATCAAGG - Intergenic
960382420 3:116980301-116980323 AAGCAGGGATTCTTAGAGGGTGG - Intronic
960590575 3:119361749-119361771 GAGCAGCGGTTCTCAGACTGTGG - Intronic
960891296 3:122451187-122451209 AAACAGTGGTTCTCAAAGTGTGG - Intronic
961617634 3:128195582-128195604 CAGCAGAGGTTCGCAGAGCCTGG - Intronic
962675213 3:137751312-137751334 TAGCAGTGGTTCTCCTAGCGTGG + Intergenic
962713680 3:138108867-138108889 AGGCAGTGGTTCTCAAAGTGTGG + Intronic
964737481 3:159931431-159931453 AGGCAGGGGTCCTCAGTGCAGGG - Intergenic
965711242 3:171558487-171558509 AATCAGAGATTCTGAGAGCGGGG - Intergenic
965740839 3:171872955-171872977 ATGCAGTGGTTCTCAGATTGTGG + Intronic
965812125 3:172602093-172602115 AAGCAGAGATTCTCAAAGTGTGG + Intergenic
966359140 3:179115411-179115433 AATCTGTGGTTCTCAGAGTGTGG + Intergenic
966389704 3:179439000-179439022 AATCTGTGGTTCTCAGAGTGTGG + Intronic
966648609 3:182274083-182274105 AATCAGTGGTTCTCAAAGTGTGG - Intergenic
966812114 3:183856068-183856090 AAGCAGGGGTTCCCAGCCCTGGG - Intronic
967920711 3:194612165-194612187 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
968203365 3:196776045-196776067 AAGCAGCAGTTCTCAAAGTGTGG + Intronic
968217075 3:196901873-196901895 AGGCAGTGGTTCTCAAAGCATGG + Intronic
969111052 4:4844507-4844529 AGCCAGTGGTTTTCAGAGCGGGG + Intergenic
969437974 4:7199511-7199533 AAGCAGGGGCTCCCTGAGCAGGG + Intronic
969658869 4:8514660-8514682 TAGCAGGGGACCTCAGAGTGAGG + Intergenic
969800327 4:9559369-9559391 AAGCAGCAGTTCTCAGATGGGGG - Intergenic
969854677 4:9989629-9989651 TATCAGGGGGTCTCAGAGCCTGG - Intronic
969948683 4:10811335-10811357 AAGCAGTGATTCTCAAAGCAGGG - Intergenic
972239179 4:37171381-37171403 AAGTAGTGGTTCTCAGAACTGGG - Intergenic
972308063 4:37851321-37851343 AAACAGTGGTTCTCAAAGTGAGG - Intronic
972685646 4:41350076-41350098 GAGCAGTGGTTCTCCCAGCGTGG + Intergenic
973729094 4:53805804-53805826 AATCAGGGGTTCTCAAAGTGTGG + Intronic
973835799 4:54807689-54807711 GAGCAGTGGTTCTCCGAGCATGG + Intergenic
974060418 4:57028748-57028770 GAGCAGAGGTTCTCAGAGTGTGG - Intronic
974794014 4:66725654-66725676 AAGCAGTGGTCCTCAAAGTGTGG - Intergenic
974871787 4:67653167-67653189 GAGCAGTGGTTCTCATAGCATGG + Intronic
975652576 4:76608920-76608942 AAGCAGTGGTTCTCAAATCTTGG + Intronic
975790703 4:77946755-77946777 TAGTAGTGGTTCTCAGAGTGTGG + Intronic
976039804 4:80869865-80869887 AAGCAGGGCTTCTGAAAGAGTGG - Intronic
976114026 4:81707577-81707599 CTGCAGTGGTTCTCAGAGTGTGG - Intronic
976880688 4:89921372-89921394 AAGCAATGGTTCTCAGACTGGGG - Intronic
978415954 4:108476287-108476309 AAGCAGAGTTTCTGAGAGTGGGG - Intergenic
979730118 4:124013908-124013930 GAGCAGTGGTTCTCCCAGCGCGG - Intergenic
980972181 4:139577030-139577052 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
980990789 4:139736649-139736671 AATTAGGGGTTCTCAAAGTGTGG + Intronic
981164635 4:141542646-141542668 AAGCAGGGGTTCCCAGCCCCTGG - Intergenic
981269031 4:142822350-142822372 AAGCAGGGGTTCCCAGCCCCTGG + Intronic
984649698 4:182257239-182257261 AAGCAGAGGTTCTCAATGGGTGG - Intronic
987075128 5:14374024-14374046 CAGCAGGTGTCATCAGAGCGAGG + Intronic
988795335 5:34648267-34648289 AGGCAGGGGTTCTCCTAGCATGG - Intergenic
989145361 5:38244218-38244240 AAGCAGTGGTTCTCAAAGTATGG - Intergenic
990530254 5:56666620-56666642 AAGAAGTAGTTCTCAGAGCTTGG + Intergenic
990817572 5:59803173-59803195 AGGCAGTGGTTCTCAGAATGTGG + Intronic
991008566 5:61857243-61857265 AAGCAGGGGTTTCCAAAGGGTGG + Intergenic
991068554 5:62451583-62451605 AAACAGTGGTTCTCAAAGTGTGG - Intronic
991633486 5:68680214-68680236 AAGCAGGGATTCTCAAACCCTGG - Intergenic
992269211 5:75048980-75049002 GAGCAGCGGTTCTCAAAGTGTGG - Intergenic
992488072 5:77214893-77214915 AAGCAGTGGTTCTCAAAATGGGG - Intronic
992524702 5:77597215-77597237 GAGCAGTGGTTCTCAAAGAGTGG - Intronic
994281862 5:97914194-97914216 GAGAAGGGTTTCTCAGAGCATGG - Intergenic
997812132 5:136981038-136981060 TAGCAGTGGTTCTCAAAGTGAGG + Intronic
998070925 5:139197657-139197679 AAGCAGGGATTTTCAAAGCCAGG + Intronic
998389372 5:141777687-141777709 CAGCAGAGGTTCTCAAAGTGTGG + Intergenic
998750670 5:145318455-145318477 AAGGAGGGTTTCCCAGAGCAAGG + Intergenic
998867138 5:146516664-146516686 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
998965043 5:147530077-147530099 GATCAGGGGTTCTCAGAGATTGG + Intergenic
999378829 5:151105701-151105723 GAGCAGTGGTTCTCAAAGTGTGG + Intronic
1000836409 5:166160235-166160257 AGGCAGTGGTTCTCACAGTGTGG - Intergenic
1001038498 5:168315202-168315224 AAGCAGGCTTTCTCAGAGTGTGG + Intronic
1001083311 5:168682543-168682565 AACCAGTGGTTCTCAAAGCGTGG - Intronic
1001425114 5:171617790-171617812 GAGCAGGGGTTCTCAGCCTGAGG - Intergenic
1001542884 5:172551450-172551472 GAGCAGCGGTTCTCAGAGTGTGG + Intergenic
1001912478 5:175532419-175532441 AAGCAATGGTTCTCAAAGTGTGG + Intergenic
1003108566 6:3234328-3234350 AATCAGGAGTTCTCAGAATGGGG - Intronic
1003236038 6:4295819-4295841 GAGCAGGGGTTCTCAAAGTGGGG + Intergenic
1003492048 6:6631518-6631540 AGGCAGTGGTTCTCAAAGTGTGG + Intronic
1004446746 6:15707420-15707442 AAGCAGTGGTTCTTAAAGTGTGG - Intergenic
1007227260 6:40324001-40324023 ACTCAGGGGTTCCCAGAGCAAGG - Intergenic
1007270561 6:40633277-40633299 ATGCAGTGGTTCTCAAAGCATGG + Intergenic
1008496404 6:52138432-52138454 GAGCAGTGGTTCTCAGAGTGTGG + Intergenic
1008912994 6:56756524-56756546 AAGCAGGGGTCCTAAAAGCCAGG + Intronic
1009998124 6:70919905-70919927 AAGCAGTGGTTCTCCCAGCACGG - Intronic
1010769537 6:79812465-79812487 ATGCAGTGGTTCTCAGCACGTGG + Intergenic
1011507293 6:88059778-88059800 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1011537424 6:88391332-88391354 GAGCAGGGGTTCTCCCAGCATGG + Intergenic
1011727572 6:90225918-90225940 AAGCAGTGGTTCTCCAAGCGGGG + Intronic
1011909747 6:92421370-92421392 AAGCAGTGGTTCTCCCAGCATGG + Intergenic
1015115681 6:129646893-129646915 AAACAGTGGTTTTCAAAGCGTGG - Intronic
1015876481 6:137827939-137827961 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1016090503 6:139972362-139972384 AAGCAGAGATTCTCAAAGAGGGG - Intergenic
1018885771 6:167935168-167935190 AAGAAGGGGGTTTCAGAGTGGGG - Intronic
1019118321 6:169783580-169783602 AAGCAGTGATTCACAGAGGGTGG - Intergenic
1019738934 7:2663365-2663387 AAGGAGGGGTTCACAGAGGAAGG - Exonic
1020444476 7:8254990-8255012 GAGCAGGGGTGCACAGAGAGTGG - Intronic
1020702195 7:11498233-11498255 AAGAAGGAGCTCTCAGAGAGAGG + Intronic
1021188982 7:17598532-17598554 TAGCGTGGGTTCTCAGAGCATGG - Intergenic
1022633724 7:32111055-32111077 AAACAGGGCTTCTGAGAGTGAGG + Intronic
1022648126 7:32250509-32250531 CAGCAGGGTTTCTCAAAGTGTGG - Intronic
1022723548 7:32961473-32961495 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
1022834698 7:34102508-34102530 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1022970762 7:35514622-35514644 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1023008496 7:35902516-35902538 AAGCAGTGGTTCTCAGACATTGG - Intronic
1023016418 7:35971894-35971916 AAGCAGTGGTTCTCAGACACTGG - Intergenic
1023175760 7:37433905-37433927 AGGCAGGGGTTCTGAGTGGGTGG - Intronic
1024058486 7:45681681-45681703 CAGCAGGGATGCTCAGAGCCCGG - Intronic
1024299732 7:47877715-47877737 TAGCAGGGGTTCTCAAAGTAGGG + Intronic
1024838969 7:53561290-53561312 AAGCAGTGGTTCTCAAAGTCTGG + Intergenic
1026375602 7:69747220-69747242 GAGCAGTGGTTCTCAAAGCGTGG - Intronic
1026533029 7:71216413-71216435 CATCAGGGGTTCTCAAAGTGTGG - Intronic
1026709772 7:72727465-72727487 CAGTAGTGGTTCTCAAAGCGTGG + Intronic
1026718844 7:72813614-72813636 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1026826467 7:73585275-73585297 AAGTAGTGGTTCTCAAAGTGAGG + Intergenic
1026926118 7:74195134-74195156 AAGCAGAGTTTGTCAGAGTGTGG - Intronic
1027645177 7:80788553-80788575 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
1028125774 7:87111432-87111454 CAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1028543526 7:91972240-91972262 AAGCAGGGTTTTTCAGGGCTAGG + Intronic
1028714755 7:93952520-93952542 AAGCAGTGGTTCTCAAAGCATGG - Intergenic
1029405335 7:100371555-100371577 AAGCAGTGGTTCTCATAATGCGG + Intronic
1029967964 7:104760171-104760193 CAGCAGGGGTTCTTAAAGTGTGG - Intronic
1030880719 7:114875333-114875355 AAGCAAGGGGTCACAGAGCTGGG - Intergenic
1031112832 7:117632076-117632098 GAGCAGGGCTTCTCAAAGTGTGG + Intronic
1031416269 7:121500087-121500109 AATCAGTGGTTCTCAAAGTGTGG + Intergenic
1032143069 7:129351743-129351765 AAGCAGTGGTTCTCAAAATGTGG + Intronic
1032491725 7:132328977-132328999 AGGCTGTGGTTCTCAAAGCGTGG + Intronic
1032913573 7:136461774-136461796 AAGAAGTGGTTCTCAAAGTGTGG - Intergenic
1032921304 7:136550909-136550931 AAGCATGGGGTCTCAGAGCAGGG + Intergenic
1034271030 7:149803522-149803544 AGGCAGGGGCACTCAGAGAGGGG - Intergenic
1034378469 7:150667353-150667375 GAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1034625500 7:152489104-152489126 ATGCAGCGGTTCTCAGCGTGTGG + Intergenic
1035051245 7:156000151-156000173 GTGCAGGGCTTCTCAAAGCGGGG + Intergenic
1035296654 7:157871189-157871211 AAGCTGTGGTTCTCAAAGTGGGG + Intronic
1035682623 8:1499305-1499327 AGGCAGGGGCTCTCACAGGGCGG - Intergenic
1035914544 8:3604870-3604892 AAGCAGGTGAACACAGAGCGTGG - Intronic
1037408031 8:18564783-18564805 AGGCAGTGGTGCTCAGAGCCAGG - Intronic
1038110483 8:24491544-24491566 AAGCAGGGGTTCCCAATTCGAGG + Intronic
1038514093 8:28169554-28169576 TAGCTGGGGTTCTAAGAGGGAGG + Intronic
1040488513 8:47897587-47897609 AAGCAGTGCTTCTCAAAGTGTGG + Intronic
1040590901 8:48791073-48791095 AGGCAGGGGGTCTCAAAGCAGGG - Intergenic
1040712795 8:50209367-50209389 AAGTAGTGGTTCTCCGAGCATGG + Intronic
1040908696 8:52495788-52495810 CAGCAGAGGTTCTCAAAGTGTGG + Intergenic
1041097048 8:54360800-54360822 AAGCAGGAGTCCACAGAGCAAGG - Intergenic
1041596172 8:59655898-59655920 ATGCAGTGGTTCTTAGAGCGTGG - Intergenic
1042841300 8:73126583-73126605 AAGCAGGGATTCTCCAAGTGTGG + Intergenic
1043160083 8:76836239-76836261 GAGCAGAGGTTCTCAAAGTGTGG + Intronic
1044693849 8:94903826-94903848 AAGCAGGGGTTGACAGGGTGGGG - Intronic
1045658798 8:104414476-104414498 GAGCAGAGGTTCTCAAAGCATGG - Intronic
1046757630 8:117988493-117988515 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1047371841 8:124262406-124262428 AAGCAGGTGTTCTCAAACTGTGG - Intergenic
1047512580 8:125526912-125526934 TAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1048473228 8:134721678-134721700 AAGGAGGGTTTCACAGAGCAAGG - Intergenic
1049842650 8:144783214-144783236 TAGCAGTAGTTCTCAGAGTGTGG + Intronic
1050051383 9:1605364-1605386 AAGCAGAGATTCTCAAAGTGTGG - Intergenic
1050094118 9:2046629-2046651 AAGCATGGGTTCTGACAGCAGGG + Intronic
1050109155 9:2196873-2196895 AACCAGTGTTTCTCAGAGTGTGG + Intergenic
1050118264 9:2282591-2282613 ACGCAGTGGTTCTCATAGTGTGG + Intergenic
1050227264 9:3474089-3474111 GAGCAGTGGTTCTCAAAGTGTGG - Intronic
1051362137 9:16290355-16290377 AAGCATGAGTTCTGAGAGTGTGG - Intergenic
1051630130 9:19133212-19133234 CAGCAGTGGTTCTCAAAGTGGGG + Intronic
1051811274 9:21052805-21052827 GAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1051931719 9:22394252-22394274 AAGTAGTGGTTCTCAAAGTGTGG + Intergenic
1052512768 9:29442274-29442296 AAGGAGGGTTTCACAGAGCATGG + Intergenic
1052770531 9:32684753-32684775 AAGCAGTGGTTCTCCCAGCATGG + Intergenic
1052853185 9:33390601-33390623 AAGCAGGGGAGCCCAGAGCTAGG + Intronic
1053931211 9:43115101-43115123 AAGCAGGGGAGCCCAGAGCTGGG + Intergenic
1054712275 9:68523278-68523300 GAGCAGTGGTCCTCAGAGTGTGG + Intronic
1054828708 9:69599631-69599653 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1055214264 9:73839533-73839555 AAGGAGGGGATCTCAGAGACTGG - Intergenic
1055472044 9:76621611-76621633 AGGCAGTGGTTCTCAAAGCTGGG + Intronic
1057267600 9:93629624-93629646 GAAGAGGGGTTCTCAGAGCCAGG - Intronic
1057599744 9:96447678-96447700 AAGCAGTGCTTCTCAAAGTGTGG + Intergenic
1057842932 9:98500789-98500811 AAGCAGTGGTTCTCAAACAGTGG + Intronic
1057960828 9:99455095-99455117 AACCAGTGGTTCTCAAAGTGTGG - Intergenic
1059396455 9:114037015-114037037 GAGCAGTGGTTCTCAAAGGGCGG - Intronic
1059614558 9:115934772-115934794 AAGCAGGGGTTCTCAACTAGGGG + Intergenic
1060111455 9:120909701-120909723 GATCAGTGGTTCTCAGAGTGTGG - Intronic
1060574734 9:124680740-124680762 AAGCAGTGGTTCTCAAAGTATGG + Intronic
1061079714 9:128362527-128362549 AAGAAGGAGCTCTCAGAGCGGGG + Intergenic
1062251351 9:135596896-135596918 AAGCAGGAGATCTCAGATCCAGG - Intergenic
1062678699 9:137764079-137764101 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1186006069 X:5073742-5073764 AACCAGGGGTTCTCAAAGTACGG + Intergenic
1186223556 X:7374717-7374739 ACCCAGGGGCTCTCAGAGCCAGG - Intergenic
1186572253 X:10727585-10727607 AAGCAGTGATTCTCAAAGTGTGG + Intronic
1186710681 X:12192846-12192868 CAGCAGGGATTCTCAAAGTGTGG - Intronic
1186773530 X:12840721-12840743 AGGCAGTGGTTCTCAAAGTGAGG + Intergenic
1187147737 X:16653333-16653355 AAGCAGTGGTTCTCCAAGTGTGG + Intronic
1187305356 X:18090453-18090475 AAGCAGGGGCTCTCAAATTGTGG - Intergenic
1187479078 X:19638602-19638624 GACCAGTGGTTCTCACAGCGTGG - Intronic
1187506584 X:19883263-19883285 ATGCAGCGCTTCTCAGAGGGTGG - Intronic
1187725993 X:22202853-22202875 TAGCAGTGGTTCTCAAAGTGCGG + Intronic
1187787124 X:22904317-22904339 AAGCAATGGTTCTCAGAGTATGG - Intergenic
1188024731 X:25196151-25196173 GAGCAGTGGTTCTCAAAGTGCGG - Intergenic
1188350680 X:29127400-29127422 GAGCAGGGATTCTCAAAGTGTGG - Intronic
1188674551 X:32922758-32922780 AAGCAGGGGTCCCCAAAGCAGGG - Intronic
1188730241 X:33637111-33637133 AAGAAGGTGTTTTCAGAGCCTGG - Intergenic
1189250748 X:39599238-39599260 AAGCAGTGGTTCTCAAAATGTGG - Intergenic
1189494557 X:41497332-41497354 AGGCAGGGCTTCTCAGACAGAGG - Intergenic
1190450971 X:50580367-50580389 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1190464252 X:50709795-50709817 GAGCAGTGGTTCTCAAAGTGTGG + Intronic
1191757262 X:64606990-64607012 AAGCAGTGGTTCTCCCAGCATGG - Intergenic
1192162163 X:68796586-68796608 AAGCAGGTGTTCTCAAAGTCTGG + Intergenic
1192654775 X:72981327-72981349 GAGCAGTGGTTCTCCCAGCGTGG + Intergenic
1192683605 X:73280604-73280626 AAGCAGGGGTTCCCAAACCTTGG - Intergenic
1193167179 X:78294482-78294504 AAGCAGGGGTTCTCCCAGCATGG - Intronic
1193640338 X:84004202-84004224 AGGGAAGGGTTCTCAGACCGAGG - Intergenic
1193781273 X:85704251-85704273 TAGCAGTGGTTCACAGAGTGTGG - Intergenic
1194334547 X:92629510-92629532 AAGCAGGGCTGCTCAGAGTGTGG - Intergenic
1195451007 X:105012959-105012981 GAGCAGGGTTTCTCAAAGTGTGG + Intronic
1197959663 X:131990093-131990115 GAGCAGTGGTTCTCACAGCATGG + Intergenic
1199236692 X:145501567-145501589 AGGCAGAGGTTCTCAGACTGAGG + Intergenic
1199394642 X:147320909-147320931 GAGTAGTGGTTCTCAGAGTGTGG - Intergenic
1200236063 X:154468273-154468295 GAGCAGGAGGTCTCAGAGGGTGG - Intronic
1200643027 Y:5746564-5746586 AAGCAGGGCTGCCCAGAGTGTGG - Intergenic
1201769124 Y:17600618-17600640 AAGCAGGAATTCTCAAAGTGAGG + Intergenic
1201832430 Y:18305367-18305389 AAGCAGGAATTCTCAAAGTGAGG - Intergenic
1201913634 Y:19158664-19158686 GAGCAGTGGTTCTCCCAGCGTGG + Intergenic