ID: 1174174482

View in Genome Browser
Species Human (GRCh38)
Location 20:48636274-48636296
Sequence GACTCTGTTTTGTTCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174174472_1174174482 12 Left 1174174472 20:48636239-48636261 CCCTCCCACTGGGACAGAAGATC 0: 1
1: 0
2: 2
3: 26
4: 236
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174480_1174174482 -10 Left 1174174480 20:48636261-48636283 CCCTGGGTACAGGGACTCTGTTT 0: 1
1: 0
2: 4
3: 56
4: 450
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174475_1174174482 7 Left 1174174475 20:48636244-48636266 CCACTGGGACAGAAGATCCCTGG 0: 1
1: 1
2: 0
3: 14
4: 194
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174469_1174174482 19 Left 1174174469 20:48636232-48636254 CCTCCCTCCCTCCCACTGGGACA 0: 1
1: 0
2: 9
3: 84
4: 690
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174470_1174174482 16 Left 1174174470 20:48636235-48636257 CCCTCCCTCCCACTGGGACAGAA 0: 1
1: 0
2: 6
3: 28
4: 307
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174471_1174174482 15 Left 1174174471 20:48636236-48636258 CCTCCCTCCCACTGGGACAGAAG 0: 1
1: 0
2: 4
3: 28
4: 274
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174474_1174174482 8 Left 1174174474 20:48636243-48636265 CCCACTGGGACAGAAGATCCCTG 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244
1174174473_1174174482 11 Left 1174174473 20:48636240-48636262 CCTCCCACTGGGACAGAAGATCC 0: 1
1: 0
2: 1
3: 20
4: 178
Right 1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG 0: 1
1: 0
2: 5
3: 35
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174174482 Original CRISPR GACTCTGTTTTGTTCACTGC TGG Intronic
900803073 1:4749496-4749518 GCCTCTGTCTTCTCCACTGCCGG + Intronic
901427386 1:9191072-9191094 GGCTTAGTTTTGTCCACTGCTGG + Intergenic
901727257 1:11251519-11251541 GAATCTATTTTGTTCACTGCTGG + Intronic
903320495 1:22540322-22540344 CAGTCTGTTCTGTTCACTGTGGG - Intergenic
904399967 1:30249710-30249732 GACTTTGTCTTAGTCACTGCTGG - Intergenic
908035043 1:60042796-60042818 GAGTCTGTTTTTATCACTGTAGG - Intronic
908140760 1:61182234-61182256 AATTCTGTCTTGTTCACAGCTGG + Intronic
908872777 1:68633611-68633633 GACGCTTTTGTTTTCACTGCAGG - Intergenic
909069647 1:70979173-70979195 GACTCTGGTTTACTCACTGAGGG - Intronic
910077201 1:83295610-83295632 CCCTCTGTCTTGTTCACTCCAGG + Intergenic
910099585 1:83561801-83561823 GAGTCTATTTGTTTCACTGCTGG - Intergenic
910365170 1:86457505-86457527 GACTCTGTTCTATTGACTGCTGG - Intergenic
912509810 1:110181487-110181509 CTGTCTGCTTTGTTCACTGCTGG - Intronic
915284726 1:154845493-154845515 GTCTCTGCTTTTCTCACTGCGGG + Intronic
917089552 1:171338843-171338865 GACTTTGTTTTGTTCACTATTGG + Intronic
918487267 1:185043200-185043222 CACTCTGTTCTGGTCACTCCAGG - Intergenic
919052602 1:192529801-192529823 GAATCTATTTTGTTCACTATTGG + Intergenic
919600618 1:199617978-199618000 GTCTCTGTGTTGGCCACTGCTGG - Intergenic
920847865 1:209608602-209608624 TAGGCTGTGTTGTTCACTGCGGG - Intronic
922456206 1:225775602-225775624 GGGCCTGTCTTGTTCACTGCTGG + Intergenic
924421660 1:243915571-243915593 GACTCTCTGTTGTTGACTGAAGG + Intergenic
1064653333 10:17532045-17532067 GGCTTTGTTTGGTTCATTGCTGG + Intergenic
1064998706 10:21318169-21318191 GACTCTGTTTTCCCCATTGCGGG + Intergenic
1065085295 10:22168658-22168680 TAGTCTGTCTTGTTCACAGCCGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1068829104 10:61472720-61472742 GACTTTGTTTTGTTCACAGATGG + Intergenic
1068927057 10:62551364-62551386 GACATTGTTTTGTCCACTGTGGG + Intronic
1069511252 10:69044140-69044162 GACTGTGTCTTGTTCCCTGTTGG - Intergenic
1069704619 10:70450524-70450546 TTCTCTGTTTAGTTCATTGCTGG + Intergenic
1070766660 10:79060639-79060661 AAATCTGTTTTGTTCACTGTTGG + Intergenic
1071845674 10:89518796-89518818 GCCACAGTTTTGGTCACTGCTGG + Intronic
1073266783 10:102232309-102232331 GACTTCGTTTCGTTTACTGCTGG + Intronic
1074277536 10:112018349-112018371 GACTCTCTGTGGATCACTGCAGG + Intergenic
1074821512 10:117182793-117182815 GCCACTTTTTTGTTCAATGCAGG + Intergenic
1075482442 10:122793881-122793903 GGAGCTGTCTTGTTCACTGCAGG - Intergenic
1076206658 10:128609641-128609663 GACTCTGCCTGGTTCCCTGCAGG + Intergenic
1076451285 10:130558588-130558610 GACTCTGTCTTCTTCATTCCAGG - Intergenic
1076472361 10:130727979-130728001 CACTCTGCTTTGTTCACTTGGGG - Intergenic
1077249067 11:1552700-1552722 GCCTCAGTTTTATTGACTGCTGG + Intergenic
1078287827 11:9975990-9976012 GATTCTATTTGGTTCAATGCTGG + Intronic
1079504186 11:21134600-21134622 GATTCTCTTTTGTGCACTGAGGG + Intronic
1080429054 11:32181944-32181966 AACTCTGCTTTCTTAACTGCTGG - Intergenic
1081482150 11:43499545-43499567 GGCACTGCGTTGTTCACTGCAGG + Intergenic
1082909873 11:58359128-58359150 AACTCTGTTTTGTTCATCACAGG - Intergenic
1084412391 11:69012397-69012419 GCCTCTGTTTTCCTCACTCCGGG + Intronic
1086318090 11:85614143-85614165 GATTCTGTCTTGTTGACTTCAGG - Intronic
1088123508 11:106396534-106396556 GATTCTGTTTTGCTTAGTGCTGG - Intergenic
1089115701 11:116093459-116093481 AACTCTGTTTTGTTTAATGTGGG + Intergenic
1089409950 11:118232497-118232519 TTCTCAGTTTTGTTCACTGCTGG + Intronic
1091765446 12:3117325-3117347 GACTCTGTTTTATAAGCTGCAGG + Intronic
1091797315 12:3304687-3304709 GACTCATGTTTGTTCACTCCAGG - Intergenic
1091841854 12:3627222-3627244 GTGTCTGTCTTGTTCACTTCTGG + Intronic
1092712846 12:11355684-11355706 GCTTCTGCTTTGCTCACTGCAGG + Intronic
1092716642 12:11395660-11395682 GCTTCTGCTTTGCTCACTGCAGG + Intronic
1094055458 12:26265010-26265032 GACTTGGTTTTGTACAGTGCTGG - Intronic
1094085292 12:26584361-26584383 AACTCTGTCTTGTTCACCACTGG + Intronic
1094095859 12:26703837-26703859 GTATCTGTTTTGCTCATTGCTGG - Intronic
1096154522 12:49334588-49334610 CACTCTGTATTCTTCAGTGCGGG - Intronic
1097039321 12:56145472-56145494 GACCCTTTTGTATTCACTGCTGG + Intergenic
1097181152 12:57172780-57172802 GACTTTGTCTGGTTCAGTGCTGG + Intronic
1097282628 12:57854109-57854131 AACTCTGTCTTATTCACTGTAGG - Intergenic
1097303224 12:58040625-58040647 ATCTCTGTTTTGTTCAGTTCAGG + Intergenic
1097786656 12:63767495-63767517 AACTCTGTTTTGCTCACAGCAGG + Intergenic
1097904572 12:64906465-64906487 CACTCTGTTCTATCCACTGCCGG - Intergenic
1098242497 12:68482536-68482558 GTTTCTGTTTTGTGCAGTGCAGG - Intergenic
1099288079 12:80739863-80739885 GATGCTGTTGTGTTCTCTGCAGG - Intergenic
1100690770 12:97036526-97036548 GTGTCTCTTTTGTTCACTGCTGG + Intergenic
1101045113 12:100796948-100796970 GACTCAGTATTTCTCACTGCAGG + Intronic
1101143671 12:101821244-101821266 AAGTCTGCTTTGTTCACTGCTGG + Intronic
1101911671 12:108864678-108864700 GATTCCATTTTGTTCACTGATGG - Intronic
1103360542 12:120351028-120351050 GACCCTGGCTTGTTCACTGCGGG + Intronic
1104308465 12:127632378-127632400 GATTCTGTTTTGCTCCCTGAAGG + Intergenic
1104338921 12:127929128-127929150 GGCTTTGTTTTTGTCACTGCTGG - Intergenic
1111094964 13:83501101-83501123 GACTCTGTTTTTTCCCCTTCCGG - Intergenic
1111230534 13:85340485-85340507 GACTCCATTTTGTTCTGTGCTGG - Intergenic
1113022491 13:105903751-105903773 GACTGTGTCTTGTTCACTTCAGG - Intergenic
1113614803 13:111672398-111672420 GACTCTGTTTAGTCCACACCAGG - Exonic
1113620272 13:111757312-111757334 GACTCTGTTTAGTCCACACCAGG - Intergenic
1114821361 14:26023514-26023536 GAGGCTGTTTTGTGCACTGTAGG + Intergenic
1115312847 14:31996570-31996592 GACTTTGTCTTGTTCATTGCTGG - Intergenic
1115825364 14:37266080-37266102 GACTCTGTGTTGATCCCTCCTGG - Intronic
1117354461 14:54910638-54910660 GACTATGATTGGTTCATTGCAGG + Intergenic
1118114871 14:62763910-62763932 GAATCTGTCTTGTCCAGTGCTGG - Intronic
1119676148 14:76556344-76556366 GTCTTTGTTTTGTTTACTGAAGG + Intergenic
1119806925 14:77488144-77488166 GTGTCTGCTTTGTTCACTGTGGG + Intronic
1120582916 14:86276379-86276401 GTCTCTAGTTTGTCCACTGCTGG + Intergenic
1121139083 14:91525045-91525067 GACTGTCTCTTGTTCACTGTTGG + Intergenic
1122864786 14:104598751-104598773 CACACTGTTTTGGTGACTGCTGG + Intronic
1124221904 15:27856569-27856591 GCCACTGTTTTGATCACTGAGGG + Intronic
1124374582 15:29122080-29122102 TAGGCTGTTTTGTTCACCGCAGG + Exonic
1127640220 15:60909146-60909168 AACTCTGTTATGCTCACCGCTGG - Intronic
1127683707 15:61321485-61321507 GACTTTGTTCTGCGCACTGCCGG + Intergenic
1128562134 15:68675852-68675874 TTGTCTGTTTTGTTCACTGCTGG - Intronic
1129106037 15:73307974-73307996 GATGCTGTTTTCTTCACTGGGGG - Intergenic
1129347632 15:74933815-74933837 CAATTCGTTTTGTTCACTGCTGG + Intronic
1129438265 15:75559404-75559426 GACTCCATTTTGTTCTGTGCTGG + Intronic
1130705291 15:86227457-86227479 GAGTCTGTTCTGTGCATTGCAGG + Intronic
1131360106 15:91783240-91783262 CACTCTGTTTGGTTCCCTGCAGG + Intergenic
1131360658 15:91787936-91787958 GTGTCTGTTTGGTTCCCTGCAGG + Intergenic
1131680916 15:94722196-94722218 GAGTCTGCATTATTCACTGCTGG + Intergenic
1131681262 15:94726071-94726093 GCCACTGTTTTCTTCACTGAGGG + Intergenic
1132088589 15:98928440-98928462 GAATCTGATCAGTTCACTGCTGG + Intronic
1132858846 16:2060070-2060092 GGCTCTGTTTTGTCAAGTGCTGG + Intronic
1137346966 16:47671855-47671877 GACTTTATCTTGTTCACTGTAGG - Intronic
1137689167 16:50408506-50408528 GGCTCTGCTTTTGTCACTGCTGG + Intergenic
1139116922 16:63965522-63965544 CACTCTGTTTTGTGCACATCAGG - Intergenic
1140364305 16:74369328-74369350 GCCTCTTTCTTGTACACTGCTGG - Intergenic
1140697545 16:77549940-77549962 CACTCTTTTTTGTTCACTATAGG - Intergenic
1141404796 16:83783007-83783029 GTCTCTGTGTTGTTCATTACAGG + Intronic
1141422038 16:83923827-83923849 CACTCTGTTCTGCCCACTGCTGG - Exonic
1141838215 16:86556751-86556773 GGCTCTGTTTTGAGCACAGCTGG - Intergenic
1203029557 16_KI270728v1_random:563442-563464 TATTCTTTTTTTTTCACTGCTGG - Intergenic
1203042164 16_KI270728v1_random:770989-771011 TATTCTTTTTTTTTCACTGCTGG + Intergenic
1143383473 17:6510573-6510595 GACCCTGTGCTGGTCACTGCAGG - Intronic
1144164239 17:12592467-12592489 CACACTGTTTTGATTACTGCAGG + Intergenic
1147861095 17:43523974-43523996 GACTCTCATTTCTTCCCTGCTGG + Exonic
1148432988 17:47657783-47657805 GACTTGGTTTTGTTCAGTTCTGG + Intronic
1153045853 18:855191-855213 GCCTCTGTTTTGTTCCTTTCAGG - Intergenic
1153501806 18:5757268-5757290 CACTCTGAATTGGTCACTGCTGG - Intergenic
1155742414 18:29305159-29305181 GACTCTGTGTAGTGCTCTGCTGG + Intergenic
1156650534 18:39221153-39221175 CACTCTGTTTAGTTCACAGACGG - Intergenic
1157090305 18:44628932-44628954 GACTTTGTTCTGTTCATTTCAGG + Intergenic
1157812302 18:50705942-50705964 GACTTTGTTTTGCTCACTGCTGG + Intronic
1158448495 18:57542235-57542257 GATTCTGCTCTGTTCACTGCAGG + Intergenic
1158671738 18:59481099-59481121 TTTTCTGTTTTGTTCATTGCAGG - Intronic
1158752968 18:60287017-60287039 TACTCTGGTTTCTTCAGTGCAGG - Intergenic
1160292440 18:77607044-77607066 GATTCTGTTTGTTTCTCTGCTGG - Intergenic
1160904385 19:1445601-1445623 GATTTTGTTTTGTTCAGTGCAGG + Intergenic
1162595640 19:11626801-11626823 GGTTCTGTTTGGTTCACAGCAGG + Intergenic
1164144891 19:22505943-22505965 GACTCTGTTTTGCTGTCTGTAGG - Intronic
1164442831 19:28292333-28292355 CTTTCTGTTTTGTTCACTGCTGG - Intergenic
1164643385 19:29842438-29842460 GTCTCTGTTTTTTTCTCTCCAGG - Intergenic
1165784607 19:38453516-38453538 TTTTCTGTTTTGTTCACAGCTGG - Intronic
1167403869 19:49291091-49291113 TTATCTGTGTTGTTCACTGCTGG - Intronic
1168280100 19:55301167-55301189 AGGCCTGTTTTGTTCACTGCTGG + Intronic
925105614 2:1288220-1288242 TTGTCTGTTTTGTTCACTGTAGG - Intronic
926715420 2:15920198-15920220 GTCTCTGTTTTGTTTACTGTTGG - Intergenic
928208724 2:29307205-29307227 GAGTCTCTTTTGATCACTGCAGG - Intronic
929492916 2:42412837-42412859 TACTCAGTTTTCTTCCCTGCTGG + Intronic
931143135 2:59485697-59485719 GACTATGTTAAGTTCACTTCAGG + Intergenic
931809499 2:65841078-65841100 GTTTCTCTTTTATTCACTGCTGG + Intergenic
935070715 2:99691285-99691307 GAGTCTCATTTGTTCACTGAGGG + Intronic
935324350 2:101922500-101922522 GACTCTGTATTGTTGACACCAGG - Intergenic
940429378 2:153570710-153570732 GACTGTCTTTTCTTCAGTGCAGG + Intergenic
941269728 2:163409942-163409964 GACTCTGTGTTGTGGACTACAGG - Intergenic
941339246 2:164286233-164286255 GACTCTAAGTTGTCCACTGCAGG + Intergenic
943058614 2:183014137-183014159 GACTTCTGTTTGTTCACTGCTGG + Intronic
943238318 2:185351059-185351081 GACTCCATTCTGTTCTCTGCTGG - Intergenic
944663084 2:201937474-201937496 GACTCTGTTTGGGGTACTGCTGG - Intergenic
944847451 2:203682848-203682870 GACTCTGCTTTGTTCATTTCTGG - Intergenic
946682828 2:222235274-222235296 TTCTCTGCCTTGTTCACTGCTGG + Intronic
946994282 2:225373454-225373476 GACTTCATTTTGCTCACTGCAGG - Intergenic
1170095241 20:12638916-12638938 GACTCTAATGTGATCACTGCTGG + Intergenic
1170230520 20:14042344-14042366 GAGTGTGTTTTTTCCACTGCAGG - Intronic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG + Intronic
1174757697 20:53175891-53175913 GGCTCTGTTCTGTTCACTGAAGG - Intronic
1175136327 20:56827100-56827122 GATTCTGTTTTGTTTTGTGCTGG - Intergenic
1175520039 20:59596766-59596788 GCATCTGTTTTGTGTACTGCTGG + Intronic
1177061765 21:16384255-16384277 AAGGCTGTTTTCTTCACTGCAGG + Intergenic
1177950513 21:27529974-27529996 TTTTCTGTTTTGTTCACTACTGG + Intergenic
1178303484 21:31471469-31471491 TTCTCTGTTTTCTTCCCTGCAGG + Intronic
1180590305 22:16931651-16931673 GATTGAGTTTTGTACACTGCAGG + Intergenic
1181402543 22:22660061-22660083 GACTCTCTGTTGACCACTGCTGG - Intergenic
1181430633 22:22879548-22879570 GACTCTGTTCTGTCCCCTGGTGG - Intronic
1181894127 22:26092032-26092054 TTGTCTGTTTTGTTCACTGCTGG - Intergenic
1182277834 22:29201649-29201671 AACTGTGCTTTGTTGACTGCAGG - Intergenic
1182361668 22:29750092-29750114 GTTTGTGTTTTGTTTACTGCTGG + Intronic
1182528194 22:30934800-30934822 GACTCTGTCTTCTTCACCACTGG + Exonic
1182649648 22:31840832-31840854 GATGCTGTTCTGTTCCCTGCTGG - Intronic
1184351390 22:43946245-43946267 GCCTCTGCTTTGGTCTCTGCTGG - Exonic
949526139 3:4906214-4906236 GACTCTGTTCTTTTCCCAGCTGG - Intergenic
952774140 3:37028404-37028426 TTCTCTGTTTTGTTCATTGCTGG + Intronic
952982499 3:38749001-38749023 GTATCTGTTTTGCTCACAGCTGG - Intronic
953239247 3:41134048-41134070 GATTCTGTGTTGTTCAATGCTGG + Intergenic
954912204 3:54120424-54120446 GAGCCTGCTTTGTTCACTACTGG + Intergenic
955727134 3:61945079-61945101 GCCCCTGTTCTGTCCACTGCTGG - Intronic
956957775 3:74360729-74360751 GTCCCTGTTTTCTTTACTGCTGG + Intronic
959222959 3:103545088-103545110 GTTTTTGTTTTGTTCACTGCTGG - Intergenic
959590348 3:108073410-108073432 TCCTCTGCATTGTTCACTGCTGG - Intronic
959626845 3:108462306-108462328 GTCTCTGTTTTGTTCATTCCTGG + Intronic
959783565 3:110265966-110265988 TACTCTCTTTTGTTAGCTGCAGG - Intergenic
960387574 3:117038441-117038463 GCCTCTGTTCTTTTCCCTGCGGG - Intronic
961522001 3:127472428-127472450 GATTCTGTTTTCTTGGCTGCTGG - Intergenic
965309487 3:167111822-167111844 AACACTTTTTTGTTCACTGAGGG + Intergenic
966065811 3:175820253-175820275 AACTCTGTTTAATTCACTGAAGG - Intergenic
966508035 3:180728953-180728975 GGCTTTGTTCTGTTCACTGTAGG - Intronic
966537755 3:181053153-181053175 GACTATGTTTTGTTTTCTGTTGG + Intergenic
966768538 3:183483595-183483617 GGCTTTGTTTTGTTCACAGATGG + Intergenic
967779905 3:193426219-193426241 GTCTTTGAATTGTTCACTGCTGG - Intronic
968262923 3:197339726-197339748 GCCTCCGTTTTTTTCACCGCAGG + Intergenic
968805747 4:2771036-2771058 GACTCTGTTTTGTGAGCTGGGGG - Intergenic
970435448 4:16029886-16029908 GACTCTCTCTTGTTTAATGCAGG - Intronic
971148050 4:24000894-24000916 AAATCTATTTTGCTCACTGCTGG - Intergenic
972204942 4:36760272-36760294 TACTCTATTTTGTTCACTGTTGG + Intergenic
973035319 4:45398389-45398411 GGATCTGTTTTGTTCACTCATGG - Intergenic
974912823 4:68144287-68144309 CACGCTGTTTTGGTTACTGCAGG + Intergenic
975681127 4:76877284-76877306 GTATCTGTTATGTTCCCTGCTGG + Intergenic
976304082 4:83542190-83542212 GACTCACTTTTTTTCACTGTGGG - Intronic
977733832 4:100387199-100387221 AACTATTTTTTGTTCACAGCAGG - Intergenic
979344500 4:119571014-119571036 TCATCTGTTTTGTTCACTACTGG - Intronic
981328263 4:143477308-143477330 TACCCTGGTTTCTTCACTGCTGG - Intergenic
982130286 4:152223236-152223258 TTATCTGTTTTGTTCACTGCTGG + Intergenic
986797573 5:11226820-11226842 GGGTCTATTTTGTTCACTGCTGG + Intronic
989180762 5:38574472-38574494 GACACTTTTTTGTTTCCTGCTGG + Intronic
992099602 5:73394343-73394365 GAGCCTGTTTTGATCTCTGCTGG - Intergenic
993504495 5:88693487-88693509 GACTCTGATTTGGAGACTGCTGG - Intergenic
993882955 5:93384151-93384173 GATTTTGTTTTGATCACAGCTGG - Intergenic
994716577 5:103328823-103328845 GACTCTGTTTTGTCCTCAGAAGG + Intergenic
996269012 5:121579754-121579776 CACTCTGTTTTACTCACTGTGGG - Intergenic
996547168 5:124692394-124692416 CCATCTGTTTTGTTCACTGTTGG - Intronic
996890023 5:128407645-128407667 GTATCTCTTATGTTCACTGCTGG + Intronic
997386096 5:133474057-133474079 GAATCTGTTTTCTTTACTGTGGG - Intronic
997411192 5:133692282-133692304 GCCTCTGTTTCGTCCACTCCAGG - Intergenic
997941106 5:138158311-138158333 GACTCTGTGTTGTTCATTATGGG - Intronic
1000390998 5:160723354-160723376 GACTGTGTTTAGTTCTCTGAAGG + Intronic
1003005793 6:2380375-2380397 AAGTCTGTTTTGCTCACTGTGGG + Intergenic
1004172694 6:13309374-13309396 GTATCTGTTTTGTTCACTGCTGG + Intronic
1004273134 6:14212349-14212371 GACTCTGTGTTCGTGACTGCTGG + Intergenic
1005269835 6:24151818-24151840 GATTCTGTTTTTTTCTCTGTGGG - Intronic
1006381344 6:33699381-33699403 CCCTCTGTTTTGTTCACCTCAGG - Intronic
1013328405 6:109071155-109071177 GACTTTTTCTTGTTCATTGCTGG - Intronic
1015150753 6:130034141-130034163 GCCTCTGTTTTATCCACTCCTGG + Intronic
1018045124 6:159959270-159959292 TACTGTGTTTTGCTCAATGCTGG - Intergenic
1018276925 6:162142654-162142676 TACTCTATTTTGGTCACTGTGGG - Intronic
1018552533 6:165014335-165014357 GGCTCTGCTTTGTACACTGTGGG + Intergenic
1019077280 6:169397889-169397911 GGCTCTGTTTTCTGCATTGCAGG - Intergenic
1019804776 7:3115672-3115694 GACTCTGTTTCATCCACTGGTGG - Intergenic
1021818439 7:24472837-24472859 GTCTTTGTTTTGCTCACTGGAGG + Intergenic
1022120979 7:27307734-27307756 GAGACAGTGTTGTTCACTGCAGG - Intergenic
1022312015 7:29206097-29206119 ATTTTTGTTTTGTTCACTGCTGG + Intronic
1022915987 7:34953392-34953414 GAATCTGTTTTACTCACTGGGGG - Intronic
1024350103 7:48354801-48354823 GACTGTGTTTCAATCACTGCAGG - Intronic
1024797047 7:53033328-53033350 GAGTGTGTTTTGATCACTGCAGG + Intergenic
1026953651 7:74363577-74363599 AACACTGTTTTCATCACTGCGGG - Intronic
1027294972 7:76760824-76760846 CCCTCTGTCTTGTTCACTCCAGG + Intergenic
1028220713 7:88193499-88193521 TACACTGTTTTGTTTACTGTAGG - Intronic
1028491930 7:91422404-91422426 GTCTCTGTTTTCTTCTCTTCAGG + Intergenic
1029574726 7:101395931-101395953 AACTTTGTTTTGTTCACATCCGG + Intronic
1029727001 7:102413111-102413133 GGCTGTGTCTTGGTCACTGCAGG + Intronic
1030029985 7:105360144-105360166 GTCTCTCTTTTGTTCTTTGCTGG + Intronic
1030964428 7:115971825-115971847 GTCTCTGTTTTCTTCTGTGCTGG - Intronic
1031641135 7:124165397-124165419 GAATCTGTTTGGTTCACTGCTGG - Intergenic
1035466589 7:159083502-159083524 GACTCTGCTATGGTCACTCCAGG - Intronic
1037311358 8:17560100-17560122 GACTCTGATTTGGTGACTACTGG + Intronic
1038746624 8:30260511-30260533 GTCAATGTTTTATTCACTGCAGG - Intergenic
1038914820 8:32009428-32009450 TGGCCTGTTTTGTTCACTGCTGG - Intronic
1040462016 8:47658446-47658468 GACTTTGATTTGTTTATTGCCGG - Intronic
1040721730 8:50332389-50332411 GACTCTGTTTTCTTGCCTGGTGG - Intronic
1040900143 8:52410147-52410169 GATTCTGTATTTGTCACTGCAGG - Intronic
1041699801 8:60775726-60775748 AATTCAGTTTTCTTCACTGCAGG - Intronic
1042301390 8:67286387-67286409 GACTCTGTATTGTTAGATGCTGG + Intronic
1044153451 8:88812236-88812258 TACTCTGTTTTTTGCACTGCTGG - Intergenic
1044309084 8:90672012-90672034 GACTGTGTCTTGTTTACTGCTGG + Intronic
1045328434 8:101134829-101134851 TTGTCTATTTTGTTCACTGCTGG + Intergenic
1045380242 8:101616705-101616727 CACCCTGTGTTGGTCACTGCTGG + Intronic
1045403001 8:101837282-101837304 GACTCTGTTTTGGTCTCAGTGGG - Intronic
1047521655 8:125599585-125599607 GACTGTGCTTTGTACATTGCGGG + Intergenic
1047881316 8:129196868-129196890 CTCTCTGTTTTGTACTCTGCTGG - Intergenic
1049653289 8:143786650-143786672 GACTTTGTTTTGTTCAAGGATGG - Intergenic
1050124561 9:2343234-2343256 GGCTCTGTGTTGATCACTGCTGG - Intergenic
1051076462 9:13243326-13243348 GACTATGTATTGTTCAATGTGGG - Intronic
1053121854 9:35553399-35553421 GATTTTATATTGTTCACTGCTGG - Intronic
1053943435 9:43279217-43279239 GGCTCTCTTTTGTGTACTGCGGG + Intergenic
1054827168 9:69585092-69585114 GCCTTTGTTTTGTTCACTACTGG - Intronic
1055638280 9:78298196-78298218 GACTTTGCCTTCTTCACTGCGGG - Intronic
1055759032 9:79587087-79587109 GAATATGTTTTGTTCACTGCTGG + Intronic
1057022637 9:91712167-91712189 CCCTCTCTTGTGTTCACTGCTGG - Intronic
1059135716 9:111803955-111803977 GAGTCTGTTCTGTTCATTGCAGG - Intergenic
1059490140 9:114660033-114660055 GAGTCTCCTGTGTTCACTGCTGG + Intergenic
1059819297 9:117954386-117954408 TTTGCTGTTTTGTTCACTGCTGG + Intergenic
1060382633 9:123191012-123191034 TTGTCTGTTTTGTTCACTGTTGG - Intronic
1060980615 9:127789474-127789496 GACTCTGGTTGGTGGACTGCTGG - Exonic
1062116351 9:134811317-134811339 GTCTCTGTCTTGTTCCCCGCAGG + Exonic
1203586555 Un_KI270747v1:9122-9144 GGCTCTCTTTTGTGTACTGCGGG + Intergenic
1186134057 X:6500282-6500304 GCCACTGTTTTGTTAACTGATGG - Intergenic
1186925208 X:14326121-14326143 TTGTCTGTTTTGTTCACTGATGG + Intergenic
1192805378 X:74504262-74504284 GACTCTGGCTTGATCAGTGCTGG + Intronic
1193924483 X:87466499-87466521 GACTCCATTTTGTTCTGTGCTGG + Intergenic
1198543415 X:137665235-137665257 GTATCTATTTTGTTCACTACTGG + Intergenic
1198636345 X:138704920-138704942 GACGATGTCTTGTTCACAGCAGG + Intronic
1198720925 X:139619272-139619294 TATTCTGTTTTGTTCAATGCAGG - Intronic
1199427122 X:147715876-147715898 GTTTCTGTCTTGTTCGCTGCTGG - Intergenic
1199571615 X:149272389-149272411 TTGTCTGTTTTGCTCACTGCTGG + Intergenic
1199690146 X:150303487-150303509 AACTCAGTTTTCTTCTCTGCAGG + Intergenic