ID: 1174176931

View in Genome Browser
Species Human (GRCh38)
Location 20:48651228-48651250
Sequence GTCCCACGCTACCTAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174176923_1174176931 29 Left 1174176923 20:48651176-48651198 CCCATATTGCACGGGAGTAAACT 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1174176931 20:48651228-48651250 GTCCCACGCTACCTAGTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1174176924_1174176931 28 Left 1174176924 20:48651177-48651199 CCATATTGCACGGGAGTAAACTG 0: 1
1: 0
2: 1
3: 19
4: 270
Right 1174176931 20:48651228-48651250 GTCCCACGCTACCTAGTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174176931 Original CRISPR GTCCCACGCTACCTAGTGGT GGG Intronic
906394651 1:45451514-45451536 GTACCACCCTACCTTGTGCTGGG - Intronic
1062998780 10:1894007-1894029 GTCCCATGCAACCTCGTGCTGGG - Intergenic
1068023689 10:51616773-51616795 GCCCCACCCTACCCAGTGGCAGG - Intronic
1069462572 10:68609274-68609296 GCCTCACCCTCCCTAGTGGTTGG + Intronic
1100442079 12:94626639-94626661 GTCCCTCTCTACCCAGAGGTGGG - Intronic
1122092992 14:99352336-99352358 GTCCCTCGCTAGCCAGTGGAGGG + Intergenic
1135973483 16:27089364-27089386 GACCCAAGGTACATAGTGGTGGG + Intergenic
1142150702 16:88511369-88511391 GCCCCAGGCTTCCTGGTGGTGGG + Intronic
1168468076 19:56620046-56620068 GTCACACGCTGCCTAGTTCTTGG - Intronic
926629402 2:15123089-15123111 CTCCCAGGCTACCTCGGGGTGGG - Intergenic
937276419 2:120686934-120686956 TTCGCACGCCCCCTAGTGGTAGG + Intergenic
938000396 2:127730042-127730064 GTCCCAAGCTACCTAGTTCTTGG - Intronic
940385972 2:153072252-153072274 GTCCCACACTGCTTAGCGGTAGG - Intergenic
946388951 2:219404217-219404239 GCCTCAGGCTACCTAGTAGTAGG - Intergenic
1174176931 20:48651228-48651250 GTCCCACGCTACCTAGTGGTGGG + Intronic
1176448580 21:6842370-6842392 TTCCCACCCCACCTTGTGGTTGG - Intergenic
1176826750 21:13707392-13707414 TTCCCACCCCACCTTGTGGTTGG - Intergenic
952716221 3:36483432-36483454 GTCCCAGGCAAACTAATGGTTGG + Intronic
959644484 3:108682261-108682283 TTCCCACTATACCTAGTAGTAGG - Intronic
961560135 3:127722993-127723015 GTACCACTCTACCTAGTGAAAGG - Intronic
969263811 4:6051161-6051183 GTCCCACGCTAGCAAGCGGCAGG + Intronic
970309220 4:14764442-14764464 GTCCTAGGCTATCTACTGGTAGG + Intergenic
1003415752 6:5906291-5906313 GTCCTCGGCTTCCTAGTGGTGGG + Intergenic
1020920889 7:14262911-14262933 GGCCCAAGCTACCTCTTGGTGGG - Intronic
1030335582 7:108322423-108322445 ATCCCACGTTCCCTATTGGTTGG + Intronic
1031888881 7:127271068-127271090 GTCACACGCCACCTAATGATAGG + Intergenic
1039711722 8:40061952-40061974 GTCCCACCCTCCCTGGTGGCAGG + Intergenic
1041177234 8:55209385-55209407 GTCTCACCCTAGCTAGTGATGGG + Intronic
1060518499 9:124280544-124280566 GCCCCACGGTACCCAGTGCTGGG - Intronic
1203520611 Un_GL000213v1:42148-42170 TTCCCACCCCACCTTGTGGTTGG + Intergenic
1189376883 X:40473550-40473572 GTCCCAGGCTGTCTAGTGGCTGG - Intergenic
1198034237 X:132784936-132784958 GTCCCACTCTACCTCGTCCTTGG + Intronic
1198518506 X:137430301-137430323 GTCCCAAGCTACTAAGAGGTGGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic