ID: 1174177893

View in Genome Browser
Species Human (GRCh38)
Location 20:48656582-48656604
Sequence GGGGGAGTCAAGGGGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174177893_1174177897 -9 Left 1174177893 20:48656582-48656604 CCAGAAATCCCCTTGACTCCCCC 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1174177897 20:48656596-48656618 GACTCCCCCCTCATCTGCTTCGG 0: 1
1: 0
2: 1
3: 8
4: 115
1174177893_1174177898 -8 Left 1174177893 20:48656582-48656604 CCAGAAATCCCCTTGACTCCCCC 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1174177898 20:48656597-48656619 ACTCCCCCCTCATCTGCTTCGGG 0: 1
1: 0
2: 1
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174177893 Original CRISPR GGGGGAGTCAAGGGGATTTC TGG (reversed) Intronic
901269495 1:7940965-7940987 CGGGGGCTCTAGGGGATTTCGGG - Intronic
901769224 1:11522015-11522037 GGTGGAGTCAAGAGGTTTTTAGG + Intronic
905228942 1:36499891-36499913 GGCTGAGTCAGGGGGATTGCTGG + Intergenic
905806384 1:40880545-40880567 GGGGAAGTCAAGGCAACTTCTGG - Intergenic
906453114 1:45969792-45969814 TGGGGAGGCAAGGGGTTTACAGG - Intronic
907385851 1:54124956-54124978 GGGGGAGTCAAGTGGAGACCAGG + Intergenic
910080377 1:83334568-83334590 GGGAGAGCCAAGGGAATTTCAGG + Intergenic
910733664 1:90427459-90427481 AGGGGAGTCAAGTGGAGTTGGGG + Intergenic
913697772 1:121344411-121344433 AGGGGAGCATAGGGGATTTCTGG + Intronic
913699101 1:121356981-121357003 GTGGGAGTTCAGGGGAGTTCAGG - Intronic
914138445 1:144923064-144923086 GTGGGAGTTCAGGGGAGTTCAGG + Intronic
914139783 1:144935640-144935662 AGGGGAGCATAGGGGATTTCTGG - Intronic
915745610 1:158154666-158154688 GGTGGAGTCACTGGCATTTCTGG + Intergenic
916979406 1:170116829-170116851 TGGGGAGAGAAGGGCATTTCAGG - Intergenic
918993352 1:191726866-191726888 GGGGGTTTGAAGGGGATCTCTGG + Intergenic
920074015 1:203323989-203324011 GGAGGATTCAAGGGGAACTCTGG - Intergenic
920485165 1:206363061-206363083 AGGGGAGCATAGGGGATTTCTGG + Intronic
920486511 1:206375693-206375715 GTGGGAGTTCAGGGGAGTTCAGG - Intronic
920593879 1:207249179-207249201 GGGGGAGTCAAAAGGATGTGAGG + Intergenic
921100767 1:211927292-211927314 GAGGGAGTCAAAAGGGTTTCTGG - Intergenic
923723491 1:236487040-236487062 GGGGGAAGGAAGGGGCTTTCTGG - Intergenic
1063159318 10:3408273-3408295 GGGAGAGCCAAGGGGACTTGGGG - Intergenic
1063386022 10:5616682-5616704 GGGGGAGTCAAGTGTTTTTACGG + Intergenic
1063464845 10:6236458-6236480 TGGGGAGTCAAGGCTATTTCTGG - Intergenic
1069051860 10:63803436-63803458 GGGGCAGCCAATGGGACTTCTGG + Intergenic
1069781785 10:70961501-70961523 GGGGGAGTGAAGGGCATTAATGG + Intergenic
1072463499 10:95641612-95641634 GGCTGAGACAAGGGGATTGCTGG - Intronic
1073453307 10:103622173-103622195 GAGGGGGACAAGGGGGTTTCGGG - Intronic
1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG + Intronic
1074783762 10:116820975-116820997 GGGGGAGGCCATAGGATTTCTGG - Intergenic
1076178462 10:128386877-128386899 GAGGGAACCAAGGGGATCTCAGG + Intergenic
1078725420 11:13926044-13926066 GGGTGAGAGAAGGGGAGTTCAGG + Intergenic
1079105793 11:17571543-17571565 GGGCGAGCCAAGGAGTTTTCAGG + Intronic
1079145571 11:17848329-17848351 AAGGGAGTAAAGGGAATTTCAGG + Intronic
1083125672 11:60563719-60563741 GGTGGAGCCACGGGGAATTCAGG - Intergenic
1083343989 11:61976927-61976949 GGGAGAGCTAAGGGTATTTCTGG + Intergenic
1083745652 11:64735264-64735286 GGGAGAGTAAAGGGGACATCAGG + Intronic
1084042298 11:66549231-66549253 AGGGCAGGCAAGGGCATTTCAGG - Intronic
1084904368 11:72334651-72334673 GTGGGAGGCAAGGGGAGGTCAGG - Intronic
1085265273 11:75234232-75234254 GTGGGAGTTAAGGCGTTTTCAGG + Intergenic
1086042818 11:82499348-82499370 GAGGGAGTGACTGGGATTTCAGG + Intergenic
1086437335 11:86795062-86795084 GGGGGTGTCAACGGGAGTCCTGG + Intronic
1089858918 11:121571714-121571736 GGGGGAGTCTATAGGATTGCAGG - Intronic
1091583682 12:1803962-1803984 GGGAGGGTCAAGGGCATTCCAGG + Intronic
1092025365 12:5235021-5235043 GGGTGGGTGATGGGGATTTCAGG - Intergenic
1092229293 12:6767669-6767691 GGGGGAGCCAATGGGATTAACGG + Intronic
1092600892 12:10062971-10062993 GGGTGAGGCAAGGGGCTTTTTGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1100367759 12:93937109-93937131 GGGGAAGGGAAGGGCATTTCAGG + Intergenic
1102822866 12:115923326-115923348 GGGTGGGTGAAGGGGATTGCTGG - Intergenic
1111238990 13:85450316-85450338 GGGCGAGTCTAGGTGATTACAGG - Intergenic
1113544954 13:111141277-111141299 GGCGGAGTAAAGGGGACTTCAGG - Intronic
1113641788 13:111962901-111962923 GGGAGAGTCCAGGGGGTTCCCGG - Intergenic
1115121789 14:29945748-29945770 AGGGGAGACAAGGGGACTTAAGG + Intronic
1115854205 14:37611680-37611702 GGGGGATTCAAAGAGACTTCGGG + Intronic
1117161842 14:52997311-52997333 GGGAAAGTCAAGGAGATTTCTGG + Intergenic
1118826906 14:69391820-69391842 GGTGGAGCAATGGGGATTTCTGG + Intronic
1122056012 14:99098889-99098911 GGGGGAGTCGGGGGGAGTGCGGG - Intergenic
1123773486 15:23553813-23553835 GGGCGATTCAAGGGCCTTTCAGG - Intergenic
1128301885 15:66571057-66571079 GGGTGAGTCGAGGGGATTAGGGG + Intergenic
1128535093 15:68484698-68484720 GGGGGAGACCAGGGGATGTCTGG + Intergenic
1128785410 15:70393351-70393373 GGGAGAGGCACTGGGATTTCAGG - Intergenic
1128996759 15:72302911-72302933 GGGGAAGTCCAGGGGAATTGTGG - Intronic
1129386023 15:75196451-75196473 CGGGGAGTCCAGGGGCTTTAGGG + Intronic
1129884478 15:79028972-79028994 GGTGGAATAAAAGGGATTTCAGG + Intronic
1133828685 16:9301963-9301985 AGGGGAGTCACAGGGATTCCAGG - Intergenic
1133860698 16:9592296-9592318 GGGGGACTCTGGGGGATTTGAGG - Intergenic
1136050199 16:27644808-27644830 GGGGTACTCAAGGGTATTTAGGG - Intronic
1137731001 16:50690386-50690408 GGAGGAGTGAAGGGGACTTCTGG - Intergenic
1138554136 16:57762337-57762359 GGGGTAGTCAAGGGGCTTTGGGG - Intronic
1139768594 16:69253983-69254005 GGAGGAGTGAAGGAAATTTCTGG + Intronic
1142135372 16:88449545-88449567 GGGAGAGAGAAGGGCATTTCTGG - Intergenic
1148978177 17:51547721-51547743 TGGGGAGTCAAGGGATTTCCTGG + Intergenic
1152112438 17:78364746-78364768 GGGGGGGTCGAGGGGAGATCTGG + Intergenic
1152823825 17:82450890-82450912 GGCGGAGCCGAGCGGATTTCCGG + Intergenic
1153904454 18:9648963-9648985 TTGGGTGTTAAGGGGATTTCAGG + Intergenic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1158521111 18:58171899-58171921 GGGGGAGTCAATGAGATGGCAGG + Intronic
1158988630 18:62845810-62845832 TGAGGAGTCAAGGGCTTTTCTGG + Intronic
1159957036 18:74526007-74526029 GAGGGCGTCAAGGGGAATGCCGG + Intergenic
1162550245 19:11354737-11354759 GTGGGAGTCAAGGGCAGGTCAGG - Intronic
1162850971 19:13430901-13430923 GGGGGAGCCAAGCAGATATCTGG + Intronic
1162854916 19:13460777-13460799 GAGGGAGTCATGTGGATGTCTGG - Intronic
1162902458 19:13803301-13803323 GGGGGAGTGAAGGGGACACCTGG + Intronic
1164632305 19:29769567-29769589 AGAGGAGTCAAGGGGATTTTTGG - Intergenic
1165282631 19:34810096-34810118 GGGGGAGGCAACAGGATGTCTGG - Intergenic
1166060493 19:40322526-40322548 GGGGGAGTCCAGGGGACTGGAGG + Intronic
1167341442 19:48918845-48918867 GGGGGATTTAAGGGGACTGCAGG - Intronic
927364545 2:22278839-22278861 GGAGGATTGAAGGGGATTTGAGG - Intergenic
927721574 2:25386574-25386596 GGTAGAGTCATGGGGATTCCTGG + Intronic
927917846 2:26948035-26948057 GGGGAAGGCAAGGGGAGTGCTGG - Exonic
928994534 2:37273000-37273022 AGTGGAGTCAAGGGAATTGCAGG + Intronic
929051201 2:37838385-37838407 GGGGGAGTCAAGTGATTTTTTGG + Intergenic
929631029 2:43462061-43462083 TGCTGAATCAAGGGGATTTCGGG + Intronic
930031615 2:47061426-47061448 GTGGGATTCAGGGGGTTTTCTGG + Intronic
930542517 2:52724686-52724708 GAGGAAGTCAAGGGGATTAGTGG - Intergenic
932779401 2:74550396-74550418 GGGGGAGTAATGGGGATGTAGGG + Intronic
934136142 2:88998022-88998044 GGAGGTGGGAAGGGGATTTCAGG + Intergenic
934953663 2:98597870-98597892 GTGGGGGTGAAGGGGAGTTCTGG + Intergenic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
936351558 2:111716608-111716630 GGGGGAGTCAAGAGCATAGCTGG - Intergenic
936413415 2:112281154-112281176 TGGGGAGTCAAGTGGATGTGGGG + Intronic
936806050 2:116333658-116333680 GGTGGAGACAAGGAGATTTTGGG + Intergenic
937015078 2:118597673-118597695 CGGGGAGTCAAGGCGGTATCGGG - Intergenic
937061163 2:118981469-118981491 AGGGGAGTAAAGGTGACTTCGGG + Exonic
937232053 2:120403943-120403965 GGGGGAGGCAAGGAAATTCCAGG + Intergenic
937283717 2:120736919-120736941 TGGGAAGTCAAGCGGATCTCAGG - Intronic
949035414 2:241813832-241813854 GGGGGAGTCACGGGGCTCTCTGG - Intronic
949035431 2:241813891-241813913 GGGGGAGTCACGGGGCTCTCTGG - Intronic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1172778139 20:37420021-37420043 GGGGGTGTGGAGGGGAGTTCAGG - Intergenic
1174139340 20:48401820-48401842 GGGACAGGGAAGGGGATTTCAGG + Intergenic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG + Intronic
1174746056 20:53064530-53064552 GGCTGAGGCAAGAGGATTTCAGG + Intronic
1175131008 20:56789453-56789475 GGAGGAGTCAAGAGGCCTTCAGG + Intergenic
1175732383 20:61362644-61362666 GGGGGAGCAAAGGGGACTTGAGG + Intronic
1184103866 22:42355989-42356011 GAGGGAGAGAAGGGGGTTTCTGG + Intergenic
1184891420 22:47381639-47381661 GGGGAATTTAAGGGAATTTCAGG + Intergenic
954354177 3:50071147-50071169 GGGGAAGGGAAGGGCATTTCAGG + Intronic
954601792 3:51876116-51876138 GGGGGCCTCAAGGAGTTTTCTGG - Intergenic
956726349 3:72159635-72159657 GGGAGAGCCAAGGGCATTCCAGG + Intergenic
959094038 3:101934155-101934177 GGGGGACTTATGGGGTTTTCAGG + Intergenic
960725441 3:120665102-120665124 TGTGGAGGGAAGGGGATTTCAGG + Intronic
967245924 3:187486456-187486478 GTGGGAGTGAAGATGATTTCAGG + Intergenic
968047639 3:195632805-195632827 GGGGTAGTGAGGGGGATGTCGGG + Intergenic
968306974 3:197657119-197657141 GGGGTAGTGAGGGGGATGTCGGG - Intergenic
968934481 4:3602858-3602880 GGGGGAGGCAAGGGGAGTGGAGG - Intergenic
969720275 4:8889723-8889745 AGGGGAGTAAACAGGATTTCTGG - Intergenic
970897312 4:21118742-21118764 GGGGGAGGCAAGGAGATTTCAGG - Intronic
971287885 4:25307932-25307954 GAGGAAGTCAAGGGGGTTGCGGG + Intergenic
975425697 4:74224540-74224562 AGTGCAGTCAAGAGGATTTCTGG - Intronic
976828191 4:89283731-89283753 TGGGGAGGAAAGGGCATTTCAGG + Intronic
983063638 4:163185952-163185974 GGGTGACTCAAGTGGATTTAAGG - Intergenic
985743975 5:1636359-1636381 GGGGTAGTGAGGGGGATGTCGGG - Intergenic
986897253 5:12385266-12385288 GGTGGAGTCTGGGGGATTGCTGG + Intergenic
988934059 5:36065438-36065460 TGGGGAGTCAGGTGGCTTTCTGG + Intronic
989707758 5:44358027-44358049 GAGGGGGGCAAGGGCATTTCTGG + Intronic
990622278 5:57573062-57573084 GGGGGAGTCAAGGAGGTTTGGGG - Intergenic
992014470 5:72561476-72561498 GAGTGAGTCATGAGGATTTCCGG - Intergenic
996202462 5:120693330-120693352 GGAGGAGTCCAGGTGATCTCAGG - Intergenic
997293195 5:132752473-132752495 TGGGGAGTCAGGGGTATGTCTGG + Intronic
999274548 5:150320694-150320716 GGGAGAGTCAAGGGCACTTTGGG - Intronic
999509124 5:152229328-152229350 GGGGTACTCAAGGGGAATTCTGG + Intergenic
1002429697 5:179195860-179195882 GGGGGAGGCAAGCGGGGTTCAGG - Intronic
1003363999 6:5455523-5455545 GGGGGAAACAAGCTGATTTCAGG - Intronic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1006845296 6:37057301-37057323 GTGGGAGTCAGGGTGGTTTCAGG + Intergenic
1007389431 6:41542046-41542068 GAGGGGCACAAGGGGATTTCTGG - Intergenic
1009279990 6:61736695-61736717 GGGGGAAACATAGGGATTTCAGG - Intronic
1011056622 6:83211237-83211259 GGGGGAAAAAAGGTGATTTCAGG + Exonic
1013511669 6:110850362-110850384 GGGAGGGTCAAGGGAATTTGGGG - Intronic
1014643492 6:123944386-123944408 TGGGGAGTCAAGGGGAAAGCTGG - Intronic
1016360350 6:143260892-143260914 GGGGGGGTGAAGGGGAATTAGGG - Intronic
1023320928 7:38996848-38996870 GGGGGAGTCAAGGTGACTGAGGG - Intronic
1023513358 7:40976757-40976779 TGGTGAGAAAAGGGGATTTCAGG - Intergenic
1027298153 7:76799834-76799856 GGGAGAGCCAAGGGAATTTCAGG + Intergenic
1028037564 7:86003667-86003689 GGGGGTATCAATGGGTTTTCAGG + Intergenic
1029232708 7:99084734-99084756 GAGGGAGTATAGAGGATTTCTGG - Intronic
1032364406 7:131285739-131285761 GGTGAAGTCAAGGGCATTCCAGG - Intronic
1032822580 7:135538057-135538079 GGGTGAATCAAGGGTTTTTCAGG - Intergenic
1036798668 8:11773625-11773647 GAGGGAGGAAAGGGCATTTCAGG + Intronic
1037955102 8:23050086-23050108 GGGTGAGTCAATGGGATCTTAGG + Intronic
1040308832 8:46226172-46226194 GGGAGAGTCCAGGGGGCTTCTGG - Intergenic
1041258041 8:55996217-55996239 GGGTGAGTAAAGGGGAGTTCAGG + Intronic
1042665225 8:71196765-71196787 TGGGGAGTAAAGGGGTTTTTAGG - Intergenic
1044745468 8:95366626-95366648 GTGGAAGTCAATGGGATTGCAGG - Intergenic
1045092955 8:98766038-98766060 GGGAGAGTCAAGGGGATGACAGG - Intronic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1052116022 9:24649213-24649235 GGCTGAGTCAAGGGTATTTATGG - Intergenic
1053206211 9:36188682-36188704 GGGGGAGCCCAGGTGATTGCTGG - Intergenic
1053419909 9:37970814-37970836 GGGGGAGTCACAGGGATGTAGGG - Intronic
1053458611 9:38251099-38251121 ACGGCAGTCAAGGGGATTTATGG - Intergenic
1054455677 9:65429122-65429144 GGGGGAGGCAAGGGGAGTGGAGG + Intergenic
1055424521 9:76180584-76180606 GTGGGAGACAAGGGGAGGTCAGG - Intronic
1059735529 9:117096115-117096137 GGGAGAGCCAAGGGGACGTCGGG - Exonic
1060003635 9:119980716-119980738 GAGGGAGTCAAGGGCAGTTTGGG + Intergenic
1060280449 9:122212635-122212657 GGAGGAGCCCCGGGGATTTCTGG - Intronic
1185477138 X:422048-422070 GGGTGGGGCAGGGGGATTTCTGG + Intergenic
1187358217 X:18598947-18598969 GGTGAAGGCAAGGGGATTCCTGG + Intronic
1187482514 X:19670911-19670933 GGAGGATTCCAGGGGAGTTCTGG - Intronic
1187757752 X:22545801-22545823 TGGGGAGCCAAGGGCATTTTTGG + Intergenic
1190282308 X:48939149-48939171 GGGGGAGTGAAGGGGAGGCCAGG + Intronic
1190526438 X:51333173-51333195 GCGGGAGTCAAGGGGAAGTTAGG + Exonic
1190542800 X:51496215-51496237 GCGGGAGTCAAGGGGAAGTTAGG - Exonic
1190546264 X:51531079-51531101 GGTGGAGTATAGGGGATTTTAGG - Intergenic