ID: 1174178126

View in Genome Browser
Species Human (GRCh38)
Location 20:48657706-48657728
Sequence GCACACGCCCCAGGCAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174178117_1174178126 10 Left 1174178117 20:48657673-48657695 CCAGCACGGCAGGTGCATCTCCC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1174178126 20:48657706-48657728 GCACACGCCCCAGGCAAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 135
1174178118_1174178126 -10 Left 1174178118 20:48657693-48657715 CCCCCACCCACCTGCACACGCCC 0: 1
1: 0
2: 7
3: 100
4: 888
Right 1174178126 20:48657706-48657728 GCACACGCCCCAGGCAAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 135
1174178116_1174178126 14 Left 1174178116 20:48657669-48657691 CCAGCCAGCACGGCAGGTGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1174178126 20:48657706-48657728 GCACACGCCCCAGGCAAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174178126 Original CRISPR GCACACGCCCCAGGCAAAGC CGG Intronic
900953858 1:5874962-5874984 GCACACGCTCCACGCCACGCTGG - Exonic
901892106 1:12275517-12275539 GCTCACGCCCATGGCAAGGCAGG + Intronic
903212953 1:21828900-21828922 CCACACCCCCCAGGTAGAGCAGG + Exonic
905235278 1:36542220-36542242 GCACCAGCCCCTGGGAAAGCTGG + Intergenic
915980762 1:160418624-160418646 GCAAACTCGCCAAGCAAAGCAGG - Intronic
920303351 1:205003031-205003053 GCACACACACCAGGCAGAGCAGG - Intronic
921167487 1:212517360-212517382 CCCCACGCCCCAGGCACCGCTGG - Intergenic
921702580 1:218284786-218284808 ACACCCGCCCCAGGGAAAGAAGG + Intergenic
1063396538 10:5692973-5692995 GAGCCCGCCCCAGGCACAGCGGG - Intronic
1064437538 10:15324320-15324342 GTAGATGCCCCAGGCAATGCAGG + Intronic
1065421416 10:25548694-25548716 GCATGTGCCTCAGGCAAAGCTGG - Intronic
1067848933 10:49743048-49743070 GCACACACCCCGCACAAAGCAGG + Intronic
1069940607 10:71952786-71952808 GCACACCTCCCAGCGAAAGCAGG - Intergenic
1070697411 10:78573278-78573300 TCACACCCCTCAGGAAAAGCCGG + Intergenic
1076510981 10:131013330-131013352 GCACAAGCCCCAGGCACCGGGGG - Intergenic
1077339137 11:2018244-2018266 GCACCCGCCTCAGGCAGAGTAGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1080395125 11:31883011-31883033 GCACTGGCCCCAGGCAAACTTGG + Intronic
1081585287 11:44380002-44380024 GCCCAAGCCCCAAACAAAGCAGG + Intergenic
1083037872 11:59657145-59657167 GCACAGGCTCTAGGGAAAGCAGG + Intronic
1084084073 11:66846786-66846808 GCACAGGCCCCAGGATGAGCTGG - Intergenic
1084646401 11:70461130-70461152 CCACACGCACCAGGCACTGCTGG - Intergenic
1085629382 11:78101134-78101156 CCAGAGGCCCCAGGCCAAGCAGG + Exonic
1090558156 11:127898820-127898842 GCACCAGCCCCAGGCAATGACGG - Intergenic
1090995348 11:131860966-131860988 GCAAAAGCCCCTGGCAAATCAGG - Intronic
1202822121 11_KI270721v1_random:73426-73448 GCACCCGCCTCAGGCAGAGTAGG + Intergenic
1091900561 12:4140944-4140966 GCAAAAGCCCCAGGCATGGCTGG + Intergenic
1094855162 12:34399624-34399646 GCACAGGGCCCAGGGTAAGCTGG + Intergenic
1099425097 12:82514203-82514225 GCACATGCCCCAGGGAAAAGGGG - Intergenic
1102064700 12:109964540-109964562 GCAAACGCTGTAGGCAAAGCAGG + Intronic
1102664810 12:114562894-114562916 GCACACCCCCCAGGGAAGCCGGG - Intergenic
1102671375 12:114622081-114622103 ACACTCACCCCAGGTAAAGCTGG + Intergenic
1103559618 12:121786528-121786550 GCAGAGGCCCCAGGAAAGGCAGG - Intronic
1107991820 13:45825480-45825502 GCACACACCCCAGGCAGGGCTGG - Intronic
1108833322 13:54506764-54506786 GAACACAGCCCAGGGAAAGCAGG + Intergenic
1109323332 13:60836638-60836660 GCACACACCCCAGGTAAAAGGGG - Intergenic
1110526078 13:76538256-76538278 GCTCACACCCAAGGCAAGGCAGG + Intergenic
1113381625 13:109810890-109810912 CCACAAGCCCCTGGCTAAGCCGG + Intergenic
1119421299 14:74509403-74509425 TCCCACTCCCCAGGCAATGCAGG + Intronic
1120193403 14:81459825-81459847 GCACACCCTCCAGTCAGAGCTGG - Intergenic
1122904123 14:104794213-104794235 GCGCACGCCTCAGGCACAGGGGG + Intronic
1123058156 14:105582073-105582095 GCTCAGGCCCCAGGCACACCTGG + Intergenic
1123082250 14:105701002-105701024 GCTCAGGCCCCAGGCACACCTGG + Intergenic
1128595909 15:68949030-68949052 GCACACACACCAGGAAAATCAGG + Intronic
1129034096 15:72639465-72639487 TCACAGGCCCCAGGCAACCCTGG + Intergenic
1129178710 15:73858093-73858115 GCAGACACCCGAGCCAAAGCTGG + Intergenic
1129215786 15:74097751-74097773 TCACAGGCCCCAGGCAACCCTGG - Intergenic
1129732924 15:77942084-77942106 TCACAGGCCCCAGGCAACCCTGG - Intergenic
1130576877 15:85100847-85100869 GCACACTACTCAGGCAAGGCAGG - Intronic
1130655587 15:85790044-85790066 GCACACATCCAAGGCAGAGCTGG + Intronic
1132045856 15:98562431-98562453 AGACAGGCCCCAGGCAAAACTGG - Intergenic
1132577567 16:671015-671037 CCACACTCCCCAGGCACAGGCGG - Intronic
1132765557 16:1532628-1532650 GCACACGCCCAAGACAGTGCTGG - Intronic
1134374630 16:13660419-13660441 TCACACAACCTAGGCAAAGCAGG + Intergenic
1139397222 16:66649861-66649883 GGCCACGCCCCAGGCAAACAGGG + Intronic
1140808928 16:78558503-78558525 GCACATGCCCCAGCTAAAGAGGG - Intronic
1141299321 16:82798737-82798759 ACACATGCCCCAGGTAGAGCTGG + Intronic
1141661404 16:85443612-85443634 GCACACGCCACGGGAACAGCAGG - Intergenic
1142012844 16:87725716-87725738 GCACACGCCCCACGAGCAGCAGG + Intronic
1144128852 17:12226402-12226424 CTTCAGGCCCCAGGCAAAGCAGG - Intergenic
1144659668 17:17059994-17060016 CCACCCACCCCAGGAAAAGCTGG - Intronic
1144660343 17:17063970-17063992 CCACCCTCCCCAGGCAAATCTGG - Intronic
1145230685 17:21171364-21171386 GAACATGCCACAGGCACAGCGGG + Intronic
1146929808 17:36768994-36769016 GCACCTGGCACAGGCAAAGCTGG - Intergenic
1147426674 17:40349000-40349022 GCTCAGGCCCCAGGGAAAGGAGG - Intronic
1149550879 17:57538451-57538473 GATCACGCCCAAGGGAAAGCTGG - Intronic
1150150920 17:62808279-62808301 GCCTCCGCCCCAGGCAAGGCCGG - Exonic
1151675273 17:75594407-75594429 ACACACTCCCCAGGCAGGGCAGG - Intergenic
1151996662 17:77613751-77613773 CCTCACGCACCAGGCAATGCAGG + Intergenic
1159593069 18:70355836-70355858 ACAACAGCCCCAGGCAAAGCAGG - Intergenic
1160500103 18:79397146-79397168 GCACACACCCCTGGCGATGCCGG + Intronic
1161407477 19:4098672-4098694 GCTCAGGCCCCAGGGACAGCTGG - Intronic
1162756729 19:12865276-12865298 GCCCACGCCCCAGCCAGAGGAGG - Intronic
1165239878 19:34457551-34457573 GCAAACTGCCCAGGCCAAGCAGG - Intronic
1166107771 19:40605781-40605803 GTGAACGCCCCAGGCCAAGCCGG - Exonic
925587843 2:5481360-5481382 GCACACACCCCAGGACAAGCGGG + Intergenic
929920944 2:46171180-46171202 GCTCAGGCCCCAGGCAAGCCAGG + Intronic
932256965 2:70296155-70296177 GCACAAGCCCCAGGCAAAAATGG + Exonic
934117577 2:88811609-88811631 GCACAGGCACCAGGCCAAGGGGG - Intergenic
934708705 2:96501934-96501956 TCACACTCCCCTGGCAAGGCAGG + Intronic
935062645 2:99621827-99621849 GGGCAAGCTCCAGGCAAAGCGGG + Intronic
935598576 2:104899222-104899244 ACACACAACCCAGGCACAGCAGG - Intergenic
936161236 2:110085671-110085693 GCACAGGCGCCAGGCCAAGGGGG - Exonic
936183427 2:110285683-110285705 GCACAGGCGCCAGGCCAAGGGGG + Intergenic
939038425 2:137160309-137160331 GCACAGGCCCCAGGCTGACCAGG - Exonic
941905950 2:170716294-170716316 GCACTCGCCCCTGGCATTGCTGG + Exonic
942558702 2:177198423-177198445 GCCCACGCCAGAGCCAAAGCTGG - Intergenic
943985471 2:194612255-194612277 GCCCAGGCCCCAGGCCATGCTGG - Intergenic
944605885 2:201351098-201351120 GCACAAACCCCAGGCAGGGCTGG + Intronic
948494302 2:238336985-238337007 GCGCAGGCCCCAGGTCAAGCAGG - Intronic
948698462 2:239746108-239746130 GCACACATCCCAGAGAAAGCAGG + Intergenic
949031090 2:241797867-241797889 GCAAAGGCCCCAGTCCAAGCAGG + Intronic
1170636179 20:18106521-18106543 GGACAGGCCCAAGGCAAAACTGG + Intergenic
1174178126 20:48657706-48657728 GCACACGCCCCAGGCAAAGCCGG + Intronic
1176062804 20:63179568-63179590 GCACTCGCCCCAGGGGAAGGGGG - Intergenic
1179173072 21:38988057-38988079 GCACAGGCCCCTGCCACAGCTGG + Intergenic
1179176499 21:39011640-39011662 GCTCAAGACCCAGGAAAAGCTGG + Intergenic
1179294417 21:40048212-40048234 GCACATGGCACAGGCACAGCTGG + Intronic
1179574957 21:42302146-42302168 ACATAAACCCCAGGCAAAGCAGG - Intergenic
1181168448 22:20995382-20995404 GCACAAGCCCCAGGGAGAGCTGG - Intronic
1181703392 22:24633307-24633329 GCACAAGCCCCAGCCCCAGCAGG - Intergenic
1183330990 22:37221409-37221431 GGACATGCCCCAGGGAATGCTGG + Intergenic
1183723408 22:39575081-39575103 GCCCACGGCCCAGGCCAGGCAGG - Intronic
1184636375 22:45835257-45835279 GCGCCCGCGCCAGGCAAAGCAGG - Intronic
1185372650 22:50468203-50468225 GCACAGGCCGCCGGCCAAGCCGG + Intronic
951671042 3:25182385-25182407 GCAGAAGACCCAGGGAAAGCAGG + Intronic
955063613 3:55515751-55515773 ACAGACGCCCCAGGGAGAGCAGG + Intronic
956692488 3:71890997-71891019 GTAAATGCCCCAGGCAAAGCTGG - Intergenic
959040422 3:101415739-101415761 GCAAAAGCCCCAGGCAAAAATGG - Intronic
967497540 3:190158715-190158737 CAACACTCCCCAGGCAAAGAAGG + Intergenic
968746007 4:2360548-2360570 GCTCCCGCCCCAGGCACTGCTGG - Intronic
979367543 4:119843385-119843407 GAACACTCCCCAGGCATTGCAGG - Intergenic
980958651 4:139453698-139453720 GTACACGCCCCCGTCAAAGGCGG + Intronic
984919138 4:184748605-184748627 GAACAAGCCACATGCAAAGCAGG + Intergenic
985126927 4:186703710-186703732 GCACCCGGCCCAGGCCAGGCTGG - Intronic
985577581 5:680701-680723 GCACACACCCCACGCAGAGGCGG - Intronic
985592512 5:772797-772819 GCACACACCCCACGCAGAGGCGG - Intergenic
994353294 5:98769952-98769974 GCCCACGACCCAGGGACAGCTGG + Intronic
998674065 5:144387616-144387638 GCATAAGCCCCAGGCTAGGCAGG + Intronic
1001454304 5:171848845-171848867 GAACACACCCCACCCAAAGCAGG + Intergenic
1002099931 5:176852453-176852475 TCACACGGCCCAGGGAAAACTGG - Intronic
1005315555 6:24599659-24599681 GCACCCGCCAGAGCCAAAGCTGG - Intronic
1007473058 6:42103289-42103311 GCACACCCACCAGACAGAGCTGG + Exonic
1019116256 6:169764938-169764960 GCACACGAGTAAGGCAAAGCAGG - Intronic
1019444134 7:1062307-1062329 GCACACGACAGAGGGAAAGCAGG + Intronic
1019661918 7:2229257-2229279 CCACAGGGCCCAGGCAAGGCTGG + Intronic
1019735531 7:2648213-2648235 GCACAGGCCACAGGCACAGAAGG - Intronic
1020083131 7:5296923-5296945 GCACGCCCCCCAGGCACGGCGGG + Exonic
1025211151 7:57020264-57020286 GCACGCTCCCCAGGCACTGCGGG - Intergenic
1025660804 7:63556583-63556605 GCACGCTCCCCAGGCACTGCGGG + Intergenic
1028951871 7:96645392-96645414 GCACAAACCCCAGACAAAGTAGG + Intronic
1029300571 7:99579873-99579895 ATACACGCTCCAGGCCAAGCTGG + Intronic
1029610697 7:101625145-101625167 ACCCACGCAGCAGGCAAAGCAGG + Intronic
1037806545 8:22060794-22060816 GGATACTACCCAGGCAAAGCTGG - Intronic
1049238446 8:141524544-141524566 GCAGAGGCCCCAGGGAAAGGAGG + Intergenic
1049347822 8:142148094-142148116 TCACACTCCCCAGGTGAAGCCGG - Intergenic
1051215050 9:14788733-14788755 ACATAGGTCCCAGGCAAAGCAGG + Intronic
1062271552 9:135712153-135712175 GCACACCCCCTAGACAAGGCCGG - Intronic
1203784289 EBV:118753-118775 GCACACGCCAGAGACAAGGCAGG - Intergenic
1187269592 X:17767879-17767901 GCAAAGGCCCCAGGCAAAAATGG + Intergenic
1195740643 X:108061652-108061674 GCACAAGCCCCTGACAAAACTGG + Intronic
1196439260 X:115703533-115703555 GCAGAAGCCCCAGGCTGAGCAGG + Intergenic
1201743145 Y:17344600-17344622 GCACACTTCCCAGCTAAAGCAGG - Intergenic