ID: 1174189969

View in Genome Browser
Species Human (GRCh38)
Location 20:48733528-48733550
Sequence CTCCCGAAGTGGTAACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174189969_1174189977 13 Left 1174189969 20:48733528-48733550 CCACCCTGTTACCACTTCGGGAG 0: 1
1: 0
2: 0
3: 0
4: 60
Right 1174189977 20:48733564-48733586 ATAAAGCCACAGCAGAGAAAAGG 0: 1
1: 0
2: 0
3: 34
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174189969 Original CRISPR CTCCCGAAGTGGTAACAGGG TGG (reversed) Intronic
901018455 1:6244492-6244514 CTCCCGAGGTGGAGAGAGGGAGG - Intronic
905775020 1:40662858-40662880 TGCCTGAAGTGGTAACAGGTTGG + Intronic
906566209 1:46803020-46803042 CTTCTGCAGTGGTGACAGGGAGG + Intronic
912523123 1:110260189-110260211 CTCCTGAACTAGGAACAGGGGGG + Intronic
915180677 1:154056676-154056698 CTCCCAAAGTGCTCACATGGTGG + Intronic
922740705 1:228012805-228012827 TGCCCCAAGTGGTACCAGGGAGG + Intronic
1069842600 10:71349097-71349119 CTCCTGGAGTTGTAAAAGGGAGG + Intronic
1076357995 10:129866820-129866842 CTGCCGCAGTGGTAGCTGGGTGG + Intronic
1081930960 11:46871103-46871125 CTCACTTAGTGGCAACAGGGTGG - Intronic
1083958023 11:65997419-65997441 CTGCAGAGCTGGTAACAGGGAGG + Exonic
1089429396 11:118409613-118409635 CTCCCCAAGAGAGAACAGGGTGG + Exonic
1089621727 11:119726581-119726603 CTCAGGAAGTGGGAGCAGGGAGG - Intronic
1091915809 12:4271327-4271349 CTCCCGAAGTGGGGGCAGCGGGG - Intergenic
1096870118 12:54587869-54587891 CTCCGAAAGTGATAACAGGAAGG - Intronic
1103932730 12:124459115-124459137 CTCCCAAAAAGGTAACAGGAGGG + Intronic
1114375817 14:22145716-22145738 CTCCAGAGGTGGTAACAGATTGG - Intergenic
1117982830 14:61358741-61358763 ATCAGGAAGTGGTAAAAGGGAGG - Intronic
1119296793 14:73539259-73539281 CTCCTGGAATGGTAACAGGACGG - Intronic
1124500172 15:30221241-30221263 CTCCTGAAGGGATATCAGGGTGG + Intergenic
1124743403 15:32317425-32317447 CTCCTGAAGGGATATCAGGGTGG - Intergenic
1133969816 16:10559427-10559449 CTCCGGAAATGGCAACAGGCGGG + Intronic
1134935681 16:18243588-18243610 CTCCCTCAGTGGCAACAGGCAGG + Intergenic
1138317031 16:56078988-56079010 CTGTGGAAGTGGTACCAGGGAGG - Intergenic
1148964401 17:51422570-51422592 CTCCCCTCGTGGCAACAGGGTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1153587619 18:6639428-6639450 CTCCGCAAATGGTATCAGGGAGG + Intergenic
1160082331 18:75740346-75740368 CTCATGCAGTGGTGACAGGGAGG - Intergenic
1160438344 18:78868298-78868320 CTCCGGAAGAGGTCACAGTGCGG - Intergenic
930099760 2:47594224-47594246 CTCCTGAAGTGGCCACAGTGGGG - Intergenic
930219576 2:48732770-48732792 CTCCCTAGGTGCTAATAGGGAGG + Intronic
941322025 2:164067651-164067673 CTCCAGAAATGGGAACAGAGAGG - Intergenic
1173590009 20:44217349-44217371 TTCCCGAAATGTTAACAGGATGG + Intergenic
1173809207 20:45946142-45946164 CTCCCCAGGAGGGAACAGGGAGG + Intronic
1174189969 20:48733528-48733550 CTCCCGAAGTGGTAACAGGGTGG - Intronic
1175310498 20:58008509-58008531 CTGCCGAGGTGGTGAGAGGGAGG - Intergenic
1176411462 21:6451529-6451551 CTCCGGAGGCGGTACCAGGGCGG - Intergenic
1177513742 21:22121891-22121913 CTCCCGAAGTGGCAAACAGGAGG - Intergenic
1179686955 21:43059851-43059873 CTCCGGAGGCGGTACCAGGGCGG - Intronic
956302953 3:67792513-67792535 CTCCAGACTGGGTAACAGGGTGG - Intergenic
969116467 4:4873371-4873393 TTCCCGAAGAGGGAACATGGGGG + Intergenic
994246631 5:97486243-97486265 CTCTCGAAGTGATCACAGTGAGG + Intergenic
999183159 5:149684580-149684602 CTCCCGAACTGTTTTCAGGGAGG + Intergenic
999676129 5:154004736-154004758 CTCAAGTAGTGGTAATAGGGAGG - Intronic
1004220739 6:13743955-13743977 CCCCCACAGTGGTAACAGCGCGG + Intergenic
1016892093 6:149016864-149016886 CTGCAGCAGTGGCAACAGGGAGG - Intronic
1020078667 7:5274982-5275004 CTCCCACAGAGGTCACAGGGAGG + Intronic
1024046868 7:45591035-45591057 CTCTCAAAGAGGTGACAGGGAGG - Intronic
1025200226 7:56957202-56957224 CTCCCACAGAGGTCACAGGGAGG - Intergenic
1025671719 7:63619730-63619752 CTCCCACAGAGGTCACAGGGAGG + Intergenic
1026552877 7:71382639-71382661 CTCTTGAAGTGGTGACAGGAAGG + Intronic
1026731226 7:72913487-72913509 CTCCCAAACTGGTGACAGTGGGG - Intronic
1030199868 7:106891837-106891859 CTGCGGAACTGGAAACAGGGTGG - Intronic
1039317198 8:36386803-36386825 CTCCCAAAGTGCTAAGAGGTAGG + Intergenic
1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG + Intergenic
1059284703 9:113162407-113162429 CTCCCGAAGTAGATTCAGGGGGG + Intronic
1061288117 9:129635736-129635758 CTCCCCATGTGGGAATAGGGTGG + Exonic
1187972005 X:24668228-24668250 CTTCAGAAGTGAGAACAGGGTGG - Intronic
1197280786 X:124533487-124533509 CTCTGGAAGAGGAAACAGGGAGG - Intronic
1197869662 X:131053028-131053050 CTCCAGAAGTCTCAACAGGGTGG - Intergenic
1198177675 X:134172431-134172453 CTCCTCAAGTGGTGGCAGGGAGG - Intergenic
1200216198 X:154369246-154369268 CTCCCCAAATGGCAGCAGGGAGG + Intronic