ID: 1174190740

View in Genome Browser
Species Human (GRCh38)
Location 20:48738671-48738693
Sequence CTGTGGGTTTGGGGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 2, 3: 72, 4: 666}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174190740 Original CRISPR CTGTGGGTTTGGGGGGAGAA GGG Intronic
900460942 1:2801880-2801902 ATGGGGGTGTTGGGGGAGAAGGG + Intergenic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
900951082 1:5858607-5858629 CTGAGGGTCTGAGGGGAGCAGGG - Intergenic
901437960 1:9261132-9261154 CCCTGGTCTTGGGGGGAGAATGG - Intronic
901490540 1:9594334-9594356 CAGGGGGTGTGGGGTGAGAAGGG + Intronic
901560491 1:10066298-10066320 TTGTGGGATTGGGGGGGGAGGGG + Intronic
902108848 1:14060970-14060992 CTGCTGGTGTGGGAGGAGAAGGG - Intergenic
902146829 1:14408729-14408751 ATATGAATTTGGGGGGAGAAAGG + Intergenic
902240967 1:15089137-15089159 AAGAGGGTTTGGGGAGAGAAAGG - Intronic
902299797 1:15493804-15493826 CTGGGGATTTGGGGTGAGCAGGG - Intronic
903830380 1:26170804-26170826 CTCTGGGTTTGGGGAGCGGAGGG + Exonic
904299771 1:29546724-29546746 CTGTGGGTTTGGGAACAGATGGG + Intergenic
904333732 1:29784135-29784157 CTGGTGGTTTCTGGGGAGAATGG - Intergenic
904521736 1:31101184-31101206 CTGTGCGTGTGCTGGGAGAAAGG - Intergenic
904604677 1:31691968-31691990 CTGTGGGTTGTGGTGGGGAAGGG + Intronic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
905020130 1:34804799-34804821 CTGTGGGGTTGGGTGGAGCAAGG - Intronic
905438464 1:37976350-37976372 GTGTGGGTTGGGGTAGAGAAAGG - Intronic
905581336 1:39084468-39084490 CTGTGGGTGTGAGGGAGGAATGG + Intronic
905633161 1:39530316-39530338 CTGTGGGTTCTGGGGGTGACAGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905852781 1:41286546-41286568 CAGTGGGGTGGGGAGGAGAAAGG + Intergenic
905904829 1:41611065-41611087 CTCAGGGTGTGGGGGCAGAAGGG + Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906409856 1:45569705-45569727 CTATGGGTTTGGTGCTAGAATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907454975 1:54569597-54569619 GTGAGGGGTTGGGGGGTGAAGGG - Intronic
907473547 1:54690251-54690273 CTTTGGGAGTGGGGTGAGAAGGG + Intronic
907626224 1:56032700-56032722 CTCTGGGTCTGGGAGGATAATGG + Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
909193515 1:72586424-72586446 CTGTGGATTTGGTGACAGAAAGG + Intergenic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910263689 1:85315912-85315934 ATGAGGGTTTGGAGGGGGAAGGG + Intergenic
910338241 1:86156784-86156806 CTTTGGGCCTGGGAGGAGAAAGG + Intronic
911075789 1:93873593-93873615 AGCTGGGTTTGGGGGGAGACAGG - Intronic
911098748 1:94077350-94077372 CTGTGGGGTTGAGGGGACACTGG + Intronic
912159807 1:106967888-106967910 ATGTGGGCTTGGGGACAGAAGGG + Intergenic
912330405 1:108815260-108815282 CTGGGAGTTTTGGGGGAGAAAGG - Intergenic
912409168 1:109467562-109467584 TGGTGGGTTTGGGGGCAGGACGG - Intronic
912435884 1:109660695-109660717 CTGAGGGATTTGGGGGAGGATGG + Intronic
912497452 1:110100690-110100712 CTCTGGGTTCCAGGGGAGAAGGG + Intergenic
912771767 1:112470776-112470798 GTGTGGGTGTGGGGGAGGAAGGG + Intronic
912954883 1:114148401-114148423 CTCTGGCTTTGGGGTGAGTAGGG - Intronic
913120770 1:115738458-115738480 CTGGGGGATTGTGGGGAGAATGG - Intronic
913245828 1:116869250-116869272 CTATGGATTTGGAGGGGGAAAGG + Intergenic
915121033 1:153629630-153629652 CTGTGTGTTGGGGGAGAGAAAGG - Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915945971 1:160152041-160152063 ATGGGGCTTTGGGGGAAGAAAGG + Exonic
915972293 1:160363279-160363301 CAGTGGGTTTGGCAGGAGAGGGG - Intergenic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
916306784 1:163344561-163344583 CTGTGGGGTAGTGGGGAGTAAGG + Intronic
916543951 1:165784455-165784477 GTGTGGGTTGGGGGGAAGAGGGG + Intronic
916697405 1:167253377-167253399 CTGTGTGTTTGGGGGGGGGGGGG - Intronic
917801408 1:178573844-178573866 CTGTGGGTGTATGGGGAGCAGGG - Intergenic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918098636 1:181354747-181354769 GAGAGGGTTTGGGGGGATAATGG + Intergenic
918168983 1:181977037-181977059 CTGTGGGGTCGGGGGGAGGCAGG + Intergenic
918304211 1:183231118-183231140 CTGTGGGGTTGGGGGTGGTAAGG - Intronic
919158145 1:193793362-193793384 CTGAGGGTTGGGGTGGGGAATGG + Intergenic
919420605 1:197365492-197365514 CTCTGGGGAGGGGGGGAGAAGGG + Intronic
919452248 1:197786372-197786394 GTGTGGGTATGGGGTGAGAAAGG + Intergenic
921470543 1:215543162-215543184 CTCTGGGTTATGGGGGAAAAGGG - Intergenic
922475723 1:225905825-225905847 CTAGAGGTTTGGGGAGAGAAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923372257 1:233326871-233326893 CTGTGGGTTTCCAGGGAGACTGG + Intergenic
923718878 1:236450532-236450554 AGGGGGGGTTGGGGGGAGAAGGG - Intronic
923805254 1:237250657-237250679 CTGGGAGTTTGGCGGGTGAAAGG - Intronic
923933447 1:238730630-238730652 CTGGGGGTTTGGGGGAAGTCTGG + Intergenic
924332476 1:242953891-242953913 CTGTGGCTGAGTGGGGAGAATGG + Intergenic
924408447 1:243777136-243777158 CCATGGGATTGGGGGGAGACGGG + Intronic
924544836 1:245016776-245016798 TTGTGGAGTTGGGGGAAGAAAGG - Intronic
924642822 1:245850049-245850071 CTTGGGGTTTGGGGGGAAAAAGG + Intronic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1063993653 10:11595130-11595152 CTGTGTGTTTGTGTGAAGAAGGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064176446 10:13079576-13079598 CCACGGGGTTGGGGGGAGAATGG + Intronic
1066486633 10:35852076-35852098 CAGTGGGTTTGGGGGCAGAGGGG + Intergenic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067307628 10:45079688-45079710 CAGTGGGTTTAGGGGCAGAGGGG + Intergenic
1067920199 10:50447926-50447948 CTGTGGAATTTGGGGGTGAAGGG - Intronic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068451529 10:57196124-57196146 TTGTGGGGTTGGGGGGAGCGGGG - Intergenic
1069062505 10:63908875-63908897 CTGAAGGTTTGGGGAGACAAGGG + Intergenic
1069283000 10:66678864-66678886 TTATGTGTTTGGTGGGAGAAAGG + Intronic
1069689859 10:70343334-70343356 ATGTGGTTTTGGGGGGGAAAAGG + Intronic
1069726285 10:70582277-70582299 CTGGGGGTTGGGGTGTAGAAGGG - Intergenic
1069921195 10:71816750-71816772 CTGTGGGTTTGGGTGGGAAGAGG - Exonic
1070567194 10:77612913-77612935 CAGTGGGGGTGGGGGGAGTAGGG - Intronic
1070764911 10:79050859-79050881 CTGGGGGTGGGTGGGGAGAAGGG - Intergenic
1071374662 10:84990447-84990469 GTGTGTGTTGGGGGGGAGGAGGG + Intergenic
1071440459 10:85687848-85687870 ATGTGTGTTTTGGGGGAGAGGGG + Intronic
1073580020 10:104656779-104656801 CTGTGGGTTAGAGGGAAAAAAGG + Intronic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1075203329 10:120424648-120424670 CTGTGGGTTCTGGAGGAGAAGGG + Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075475327 10:122729154-122729176 CTGTTAGTTAGGGGGCAGAAGGG - Intergenic
1075645623 10:124094106-124094128 CTTTGGGTTGGGGGGGCGGACGG - Intergenic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076220753 10:128731450-128731472 CTTTGTGTTTGAGGGGAGAAAGG + Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076347532 10:129789915-129789937 CTGTTGGTGTGGGTGGGGAAAGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076434310 10:130429658-130429680 CTGTGTGTCTGGGTGGAGAGAGG + Intergenic
1076479257 10:130773968-130773990 CTATTGGTTTTGGGGGAGACGGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077082928 11:733316-733338 CTGTGTGTGTCGGGGAAGAATGG - Intergenic
1077144822 11:1040148-1040170 CTGTGGGTTTGGGGAGTGTTTGG + Intergenic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077791326 11:5443437-5443459 ATGTGGGTTTAGGGGAAGAGAGG - Intronic
1078653928 11:13220718-13220740 CTGTGACTTGGGGAGGAGAAGGG - Intergenic
1079138124 11:17787998-17788020 CTGTGGGGTTGGCCGAAGAAGGG - Intergenic
1079155296 11:17940532-17940554 GTGTGGGTTTGGGCAGAGCATGG - Intronic
1080305999 11:30837043-30837065 ATGTGTGTTTGAGGGGAGGATGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1080586818 11:33690079-33690101 CTTTGGTTTTGGGGGGAAACAGG - Intergenic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1081243027 11:40730102-40730124 TTGTGGGGTTGGGGGGGGCAGGG + Intronic
1081340564 11:41922181-41922203 CTAAGGGTTTGAAGGGAGAAGGG + Intergenic
1081559231 11:44197537-44197559 TATTGGGTTTGGGGAGAGAATGG + Intronic
1082995133 11:59248084-59248106 ATGGGGTTTTGGGTGGAGAAGGG - Intergenic
1083205355 11:61145513-61145535 CTGTGGCATTGGTGAGAGAAAGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083841145 11:65304972-65304994 GGGTGGGGGTGGGGGGAGAATGG - Intronic
1083932942 11:65855830-65855852 GTGTGGGTTTGGAGGGGGAGGGG - Intronic
1083958804 11:66002609-66002631 CAGAGGGGTTGCGGGGAGAAGGG + Intronic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1084496660 11:69509129-69509151 CTGATGGTTTGGGGGCAGGAAGG + Intergenic
1084661538 11:70549342-70549364 CTGTGGGCTTGGGGTGAGAGAGG - Intronic
1085129081 11:74022244-74022266 CTGTGGGTCATGGGGGATAAAGG + Intronic
1085667551 11:78428394-78428416 CTGGGGGGTGGGGTGGAGAAAGG + Intergenic
1085961079 11:81462882-81462904 AGGTGGGTTTGGGGGGAGAGGGG - Intergenic
1087391981 11:97546840-97546862 CTATGGGTTTGAGGGAGGAAGGG - Intergenic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1088587553 11:111372834-111372856 TTGTGTGTTGGGAGGGAGAAGGG + Intronic
1088660146 11:112037210-112037232 CTGTGAGTTTGGAGGGATAGTGG + Intronic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1088882680 11:113984021-113984043 ATGAGGGTTTGGGGCTAGAAAGG - Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089369684 11:117946632-117946654 CTGTGGGTTTGGGCTGAGCCAGG + Intergenic
1089563382 11:119357104-119357126 GGGTGGGTTTGGGGGGAGGGTGG + Intronic
1089577673 11:119458156-119458178 CAGGGGGATTGTGGGGAGAATGG + Intergenic
1090180775 11:124697322-124697344 CTGTGGGTTTGTGGGCTGACAGG + Exonic
1090221118 11:125026891-125026913 CTGGGGCTTTGGGGGAAGAGTGG - Intronic
1091012981 11:132023272-132023294 ATGTGGGTTTTGGGGCAGAGAGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1092667849 12:10824963-10824985 CTTTGGGTTTTCTGGGAGAATGG + Intronic
1092845641 12:12582409-12582431 CTTTGTGGTTGGGAGGAGAAAGG + Intergenic
1092897435 12:13026315-13026337 CTGAAGGTTGGGGGGAAGAAGGG - Intergenic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093236014 12:16609293-16609315 CTTTGGGGTTGGGGGGAGCCAGG - Intronic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1094252834 12:28385797-28385819 CTGTGGATTTGTTGGGACAATGG + Intronic
1094689713 12:32756694-32756716 CTCTGAGTTGGGGGGGAGACTGG + Intergenic
1094785086 12:33838821-33838843 TTGTGGGGTTGGGGGGAGCGGGG + Intergenic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1095878066 12:47103761-47103783 CTTTGAGCTTGGGTGGAGAAAGG - Intronic
1096359140 12:50968391-50968413 GTGTGTGTGTGGGGGGAGACAGG + Intronic
1096409229 12:51365262-51365284 CCTTGGGATTGGGGTGAGAAAGG + Intronic
1096725145 12:53555341-53555363 GTGAGGGTTTGGGGGAAGGAGGG + Intronic
1096806910 12:54146567-54146589 CAGTGGGGGTGGGGGGAGAGTGG - Intergenic
1097034524 12:56114487-56114509 CTATGGATTTGGGGTGATAATGG + Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098596129 12:72274004-72274026 TTGTGGGTGGGGGTGGAGAACGG - Intronic
1098957944 12:76706841-76706863 CTGTAGTTTTGGGGAGAGGAAGG + Intergenic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1100119806 12:91356312-91356334 CTGTGAGTTGGGGTGGAGCAGGG + Intergenic
1100318738 12:93469641-93469663 ATGTGGGTTGGGGAGGGGAATGG + Intronic
1101330799 12:103756427-103756449 CTGAGGGTTTGGGGAGACAATGG - Intronic
1101390026 12:104291926-104291948 CTTTGGGTTTCAGTGGAGAAAGG + Intronic
1101651878 12:106684675-106684697 CTGTGGGTGGGGGAGGAGCATGG - Intronic
1102520414 12:113474662-113474684 TTGTGGGGTTTGGGGGAGAATGG - Intergenic
1102760041 12:115377077-115377099 CGGTGGGTTAGGGGGCAGAGGGG - Intergenic
1103215239 12:119196681-119196703 CTGTAGGGTGGGAGGGAGAAGGG + Intronic
1104461946 12:128963276-128963298 CTGTGGGTTTGGGAGTGGAGTGG + Intronic
1104879655 12:132061754-132061776 CTGTGTGTTTGTGGGTAGCATGG + Intronic
1105458210 13:20560428-20560450 CAGTGGGCTTGAGGGGAGATTGG - Intergenic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1106298467 13:28440104-28440126 ATGTGGGCTAGGGTGGAGAAGGG - Intronic
1107585701 13:41845902-41845924 CTGTTGGTTTGGGGTATGAATGG - Intronic
1109592614 13:64505933-64505955 CTGTGTGTGTGTGTGGAGAAAGG - Intergenic
1109863588 13:68232543-68232565 CTGTGTGTCTGGGTGGAGACAGG + Intergenic
1110181772 13:72625979-72626001 CTGTGGGTTCTGTGGGAGCAGGG + Intergenic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110807827 13:79778248-79778270 GTGTGTGTTTGGGTGGACAAGGG - Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111797045 13:92935064-92935086 ATGAGGATTTGGAGGGAGAAGGG + Intergenic
1111962462 13:94826188-94826210 CTGGGGGTTTGGGGGGTGGGGGG - Intergenic
1112851651 13:103713417-103713439 GTGTGAGTGTGTGGGGAGAAAGG - Intergenic
1113399707 13:109979564-109979586 CTGTGGGTCCTGGGGGAGCATGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114083243 14:19219476-19219498 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1114237452 14:20835195-20835217 CTGAGGGTTTGAAGGGGGAAGGG + Intergenic
1114455324 14:22849936-22849958 CTGTCAGATTGTGGGGAGAAGGG - Intergenic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1115003050 14:28444133-28444155 CTGTGTGTGGGGGGGGAGAGGGG + Intergenic
1115105277 14:29753607-29753629 CTCTGGGCTGGGGAGGAGAAAGG - Intronic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1115769052 14:36651891-36651913 ATGAGGGTTTTGGGGGATAAAGG - Intergenic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1116162573 14:41288570-41288592 CAGTGGGTTTGGGGCATGAATGG + Intergenic
1117487428 14:56212467-56212489 CCCTGGGATTGGGGGGAGAGAGG + Intronic
1117913986 14:60658004-60658026 GTGTGGATTTGGGTGGAGAATGG - Intronic
1118978095 14:70694598-70694620 GTGTGGGCTTGGGAGGGGAAGGG - Intergenic
1119218446 14:72887138-72887160 GTGTGTGTTTGGAGGCAGAAGGG - Intronic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1119583627 14:75811197-75811219 GTGTGTGTTTGGGAGTAGAAGGG + Intronic
1120490228 14:85168778-85168800 CTGTGGGGTTGGCGGGTGCAGGG - Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121414523 14:93770045-93770067 CTGTGGCTGTAGGGGGAGAGCGG - Intronic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1121775157 14:96585424-96585446 CTGTGTGTTGGTGGGGAGAGAGG + Intergenic
1122359225 14:101149488-101149510 CTGTTGCTTTTGGGGGAGAGGGG + Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122859499 14:104576211-104576233 GTGTGGGTTTGGGGTTAGAGGGG - Intronic
1202894865 14_GL000194v1_random:1246-1268 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1124011558 15:25843269-25843291 ATGTGGGTTTGGGTGGTGATAGG - Intronic
1124087582 15:26565521-26565543 CTGTGGCTTTGCTGGGATAAAGG - Intronic
1124668354 15:31614135-31614157 TTGTGGACTTGGGGGAAGAATGG + Intronic
1125196957 15:37058141-37058163 AGGTGGGTGTGGGGGGAGTAGGG - Intronic
1125430105 15:39585089-39585111 TTATGTGTTTGGGGGGAGGAAGG - Intronic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1128350208 15:66883441-66883463 ATGTGGGTTGTGGGGGAGATGGG - Intergenic
1128658591 15:69481198-69481220 CTGTGGGTTGGGTGCGGGAATGG - Intergenic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1129570834 15:76682260-76682282 CTGTGGGGTGGGGGGGGGAAGGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129852108 15:78799283-78799305 GTGGGGGTTTGGGAGGAGTAGGG - Intronic
1130250895 15:82299804-82299826 GTGGGGGTTTGGGAGGAGTAGGG + Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130540174 15:84816778-84816800 CTGGGGGTGTTGGGGGAGACAGG + Exonic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131901924 15:97097252-97097274 GTGTGTGTTTGGAGGCAGAAAGG + Intergenic
1132010045 15:98267635-98267657 CTGTGGCTTAAGGGAGAGAAGGG + Intergenic
1132305014 15:100804800-100804822 CTGTGGCTTTGGGGCCTGAAGGG + Intergenic
1132655718 16:1040986-1041008 CTGGGGGTCTGGGAGGAGATGGG - Intergenic
1132819913 16:1859836-1859858 CTGCGGGTTTGGGGAGTGGATGG + Intronic
1132887738 16:2189871-2189893 CTGTGGGTTTGGGGGGTGCTAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1133726525 16:8542611-8542633 CTGTGGGTTTGGGGTGGGGGAGG + Intergenic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1135492399 16:22920975-22920997 CTGGGGGTTGGGGGGCAGAGTGG - Intergenic
1136221239 16:28830508-28830530 GTGTATGTTTGGGGGCAGAAGGG + Intronic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1137334516 16:47534112-47534134 CTGTGGGGTTGGCGGGAGCCAGG - Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137725696 16:50655217-50655239 CTCTGGGTGTGGGGCCAGAAAGG - Intergenic
1138199325 16:55077461-55077483 ATGGGGGTTGGGGGTGAGAAAGG - Intergenic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139166577 16:64573091-64573113 CTCTGGTTTTGAGGAGAGAAGGG - Intergenic
1139261598 16:65599569-65599591 CTGTGTGTTGGGGGTGAGATGGG + Intergenic
1139767066 16:69239496-69239518 CTAAGGGTTAGGGGTGAGAAGGG - Intronic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1141028361 16:80568531-80568553 GTGTGGGTGAGTGGGGAGAATGG - Intergenic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141493929 16:84393735-84393757 CTATGGGTGTGGGGGGAGTGGGG + Intronic
1141523776 16:84598642-84598664 GGGGGGGTTGGGGGGGAGAAGGG - Intronic
1141575239 16:84959252-84959274 CAGTGTGTTTGGGGGGTGAATGG + Intergenic
1142045869 16:87924936-87924958 CTCTGTGATTGGGGAGAGAAGGG - Intronic
1142185360 16:88692300-88692322 CTGTGGGTTTGTGGGGACTGGGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142631087 17:1227296-1227318 ATGTGGGTCTGGGGGGAGACAGG + Intronic
1143015824 17:3890666-3890688 GTGTGGGGTTGTGGGGAGCAAGG - Intronic
1143203333 17:5127035-5127057 GGGTGGGTTTGGGGTGGGAATGG + Intronic
1143754586 17:9057128-9057150 CTGCGGGGTGAGGGGGAGAAGGG - Intronic
1144185580 17:12792097-12792119 CAGTGTGTTTGGGGCAAGAAAGG - Intronic
1144713211 17:17416521-17416543 CTGTGGCTCTGTGGGGAGATGGG + Intergenic
1144788101 17:17842864-17842886 CTGTGGGGATGGGAGGAGACAGG + Intergenic
1145006753 17:19342745-19342767 CTGTGGGTAGGGGGGCAGAGAGG + Intronic
1146061112 17:29607886-29607908 CTGTGGGGCTGGGGTGAGCAGGG - Intronic
1147182211 17:38693567-38693589 CGGTGGGTGTGGGGTGGGAAGGG + Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148177975 17:45584463-45584485 CGGCGGGGTTGGGGGGAGATCGG + Intergenic
1148234744 17:45961307-45961329 CTGGGGCTTTTGGGGAAGAAGGG + Intronic
1148354744 17:46968368-46968390 CAGTGGGTTGGGGCAGAGAAAGG - Intronic
1148650512 17:49247072-49247094 CCTTGGGTTGAGGGGGAGAAGGG - Intergenic
1149001821 17:51765140-51765162 TTTTGGGGTTGGGGGGAGAAGGG + Intronic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149627507 17:58090258-58090280 GTGTGGGGTTTGGGGTAGAAGGG + Exonic
1149661768 17:58337897-58337919 TTGTGGGTTGGGGGGCAGAGGGG + Intergenic
1151521533 17:74633853-74633875 CTGACGGTTGTGGGGGAGAAGGG + Intergenic
1151555682 17:74845621-74845643 CTCTGGGTTTGGGGGCAGGCTGG + Intronic
1152039065 17:77891627-77891649 CTGTGGGATTGCAGGCAGAAGGG - Intergenic
1152524431 17:80879426-80879448 ATGTGGGAGTGGGAGGAGAAAGG - Intronic
1152681644 17:81671579-81671601 CTGTGGGTTTTGGGGTGGTAAGG + Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1153107272 18:1542231-1542253 GTGTGATTTTGGGGGGTGAAAGG + Intergenic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1155451090 18:25963647-25963669 CAGTGGGTTTGGGGTGGGAATGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156002538 18:32401172-32401194 TCGTGGGGTTGGGGGGAGAGGGG + Intronic
1156442101 18:37200878-37200900 CTGTGGGTTGGGGGAGGGAGAGG - Intronic
1156812176 18:41266044-41266066 ATGTGTGTTTGGAGAGAGAAAGG + Intergenic
1156918106 18:42485365-42485387 GTGTGTGTTTGGAGAGAGAATGG + Intergenic
1157651021 18:49331143-49331165 CTGCAGGTTTGGGAGGAGTAAGG + Intronic
1158050964 18:53219453-53219475 CTGGGGTTTTGGGGGGAAAGGGG - Intronic
1158806455 18:60979576-60979598 GTGTGGGTTTGGGCAGAGACAGG - Intergenic
1159183190 18:64937158-64937180 ATGGGGGGTTGGGGGGAGTAGGG - Intergenic
1159502235 18:69288526-69288548 CTGGGTATTTGGGAGGAGAAGGG + Intergenic
1159927439 18:74281771-74281793 GTGTGTGTTTCAGGGGAGAAGGG + Intronic
1160066632 18:75581495-75581517 CGGTGGGTGTGGGGAGAGAAAGG - Intergenic
1160130147 18:76218275-76218297 CTGTGAGTGTGGGGGATGAAGGG - Intergenic
1160192073 18:76722733-76722755 CTGTGGGGTTGGGGAGACAGCGG + Intergenic
1160349391 18:78161930-78161952 CTGTGTGATTGGGGGAACAAGGG - Intergenic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1162298279 19:9828180-9828202 CCGGGGGGTTGGGGGCAGAACGG + Intronic
1163229424 19:15990135-15990157 TGGTGGGGTTGGGGGGAGGATGG + Intergenic
1163321721 19:16578487-16578509 CTCTGGGGTTGGGGAGAGACTGG - Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1164528230 19:29027404-29027426 TTGTGCATTTGGGAGGAGAACGG + Intergenic
1164852294 19:31494187-31494209 CTGTGGAGTTGGGTGGAGGATGG - Intergenic
1165120778 19:33557103-33557125 CTGGGGGTTGTGGGGGAGACTGG - Intergenic
1165901751 19:39172594-39172616 CTGAGGGGTTTGGGGGAGGAAGG - Intronic
1165965314 19:39572953-39572975 CTGGGGACTTGGGGGGAAAAGGG - Intergenic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1166432877 19:42741609-42741631 CTGTGTGCTTGCTGGGAGAAGGG - Intronic
1166445867 19:42856863-42856885 CTGTGTGCTTGCTGGGAGAAGGG - Intronic
1166448846 19:42880824-42880846 CTGTGTGCTTGCGGGAAGAAGGG - Intronic
1166453247 19:42919014-42919036 CTGTGTGCTTGCGGGGAGAAGGG - Intronic
1166465529 19:43027598-43027620 CCGTGTGCTTGCGGGGAGAAGGG - Intronic
1166485285 19:43206752-43206774 CTGTGTGCTTGTGGGGAGAAGGG - Intronic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
1166979629 19:46624923-46624945 GTGTGGGGTTAGAGGGAGAAAGG - Intronic
1167420455 19:49399572-49399594 CTGGGGTGTTGGGGGCAGAAGGG - Intronic
1167695942 19:51015721-51015743 CTGTGAGTCTGAGGGGAGGAGGG - Intronic
1167784823 19:51628086-51628108 CTAGGGCTTTGGGGAGAGAAGGG + Exonic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168105380 19:54162940-54162962 CTCTTGGTTTGGGCGGAGAGGGG - Intronic
1168260046 19:55188169-55188191 CTACGGGTTTTGGGGGAGCAGGG + Intronic
1168508820 19:56958400-56958422 TTGTGTGTTTGGGGGTGGAAAGG - Intergenic
924981751 2:229038-229060 CTGTGGCTTTGGGTGCACAAAGG - Intronic
926030835 2:9586578-9586600 CTGTGGTTGTGAGGGGACAATGG - Intronic
927476796 2:23419931-23419953 CTGTGGCTCAGTGGGGAGAAGGG - Intronic
927581155 2:24249352-24249374 CAGTCAGTTTGGGGGGAGGATGG - Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929167786 2:38901078-38901100 GTGTGTGTTTGGGGTGAGAGTGG - Intronic
929309727 2:40408456-40408478 CTGTGGTTTTAGGAGGAGAATGG - Intronic
931877268 2:66527634-66527656 GTGTGTGTTGGGGGGGAGACAGG + Intronic
932229185 2:70068453-70068475 CTGTGAGTCTGGCTGGAGAACGG + Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933164642 2:79062755-79062777 CTGAAGGTTTGGTAGGAGAAAGG - Intergenic
934686392 2:96325184-96325206 CCGTGGGTTTGCTGGGAGAGTGG - Intergenic
935552700 2:104475235-104475257 CTGTGGGTCTGTGGGGACAGAGG - Intergenic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936248420 2:110848562-110848584 CTGTGGATTTGCTAGGAGAAGGG + Intronic
936399506 2:112154773-112154795 TGGTGGGTTTGGGAGGGGAATGG + Intronic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937081385 2:119142508-119142530 CTTTGAGTTTGGGGGCAGAAAGG - Intergenic
937983663 2:127629023-127629045 CTGTGGGCTATGGGGGAGCATGG + Intronic
938405833 2:131032650-131032672 CTGTGGCTTTGGGAGGACAAAGG - Intronic
938493339 2:131777154-131777176 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
938782238 2:134595258-134595280 TTGTGGGGTTGGGGGGAGTGGGG - Intronic
938837092 2:135115940-135115962 CTGTGGGGTTGGGGGGAATGGGG + Intronic
939428448 2:142071816-142071838 CTGAGGTTTTGGAGAGAGAAGGG - Intronic
939480506 2:142741829-142741851 CTATGGGATCTGGGGGAGAAGGG + Intergenic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
939922676 2:148136316-148136338 CTGGGGGGTAGGGGGAAGAATGG + Intronic
940007966 2:149026544-149026566 CGGGGGGTTTGAGGGGAGAATGG + Exonic
940117699 2:150227327-150227349 CTGTGGGATACGGGGGAGACTGG - Intergenic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
940834653 2:158507554-158507576 CTCTGCTTTTGGAGGGAGAATGG + Intronic
941139955 2:161767916-161767938 CTGAGGTTTTGGGGGAAGATTGG - Intronic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
941258108 2:163259196-163259218 TTGTGGGTTTAGGGGAAGGAGGG - Intergenic
941571826 2:167179889-167179911 CTTTGGGTGTGTGGGGCGAAAGG - Intronic
942045365 2:172096556-172096578 CACCGGGGTTGGGGGGAGAAGGG + Intergenic
942362492 2:175187140-175187162 ATGTAAATTTGGGGGGAGAATGG - Intergenic
942717148 2:178906361-178906383 CTGTGGGTATATGAGGAGAAAGG + Intronic
943116334 2:183676298-183676320 ATGGGGGTTTGGGGGCAGGAGGG + Intergenic
943627980 2:190219854-190219876 CTGTGGGTTTGGATGGACAGAGG + Intronic
944136611 2:196406498-196406520 CTCTGGCTTTTGGAGGAGAATGG - Intronic
944193079 2:197024021-197024043 CTGTGAGTATGTGGGGAGACAGG + Intronic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
945257270 2:207813182-207813204 GGGTGGGGGTGGGGGGAGAAGGG - Intergenic
945266162 2:207893317-207893339 CTTTGGGTTTTGGGGGAGCAGGG + Intronic
945384705 2:209183265-209183287 TTGTGTGTTGGTGGGGAGAAGGG - Intergenic
945515502 2:210759109-210759131 TTGTGGGGTTGGGGGCAGAGGGG - Intergenic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
948002321 2:234578346-234578368 GTGTGTGTTTTGGGGGAGGAGGG - Intergenic
948023207 2:234754380-234754402 CTGTGGCTTTGAGGGGTGAGGGG + Intergenic
948292741 2:236838480-236838502 ATGTGGCTTTGGGGGAAAAAAGG - Intergenic
1168805923 20:672282-672304 CTGTGGGCTTGGGGGGACCCTGG + Intronic
1168983225 20:2025581-2025603 GTGTGGGTGTGGGGAGTGAAAGG - Intergenic
1169221305 20:3824624-3824646 CTGTGGGTTTGGAAGAAGAGCGG - Exonic
1170890529 20:20371490-20371512 CAGTCTGTTTGGGGGGAAAATGG + Intergenic
1170956914 20:20989532-20989554 CGGTGGTTTTGGGGGGAAAGAGG + Intergenic
1171502281 20:25603309-25603331 CTCTGGGTTTGGGTGAAGGAAGG - Intergenic
1172190455 20:33059272-33059294 CTGTGGGTTTGAGGTGAGATAGG + Intronic
1172405919 20:34689061-34689083 CAGTGGGGTTGTGGGGAGCAAGG + Intergenic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1172517162 20:35542749-35542771 ATGTGGGTTTTGGAGGGGAAGGG - Intronic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1173015872 20:39225336-39225358 CTGAGGGTTTAAGGGAAGAATGG + Intergenic
1173242129 20:41306453-41306475 CTGTAGGCTTTGGGGAAGAAAGG - Intronic
1173558965 20:43988629-43988651 CTGTGGGTTTCGTGGGGGCAGGG + Intronic
1174065478 20:47861701-47861723 GTATGGGTTTGGGGGGTGCAAGG - Intergenic
1174184979 20:48699980-48700002 CTGGGGGTTTGGGAGGTGAATGG - Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174556398 20:51398432-51398454 CTCAGGGTTGGGCGGGAGAAGGG - Intronic
1175134085 20:56809979-56810001 CTGTTGGTTAGGTGGGAGAAGGG - Intergenic
1175229180 20:57462575-57462597 ATGTGGGATTTGGGGAAGAAAGG + Intergenic
1175353080 20:58340084-58340106 TTGTGGGGTTGAGGGGAGAAAGG + Intronic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1176614562 21:9017233-9017255 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1177098209 21:16866015-16866037 GTTTAGGTTTGGGGGGAAAAGGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178036511 21:28589397-28589419 CTGAGGGGGTTGGGGGAGAAAGG + Intergenic
1178492890 21:33064681-33064703 CGATGTGTTTGGGGAGAGAATGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179881274 21:44294253-44294275 GTGTGGGTGTGGGTGGAGAGTGG - Intronic
1179893486 21:44349488-44349510 GTGTGGCTTTGTGGGGTGAAAGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180294730 22:10873791-10873813 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180497536 22:15903205-15903227 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180742181 22:18061364-18061386 CAGTGTGTGTGGGAGGAGAACGG + Intergenic
1180968387 22:19802263-19802285 CAGTGAGTTTCGGGGGAGAAGGG + Intronic
1181259982 22:21590836-21590858 CTGGGGCTTTGGGAGGAAAAAGG - Intronic
1181631418 22:24153569-24153591 CTGGGGGGTTGGGGGGTGACAGG + Intronic
1181749811 22:24981389-24981411 GTGTGTCTTTGGTGGGAGAAAGG + Intronic
1181953418 22:26571153-26571175 CAGTGGGGTTGGGGGCAGAAAGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182128913 22:27836415-27836437 ATGCGGGTTTGGGGGAAGGAGGG - Intergenic
1182147343 22:28004654-28004676 GTGTGGGCTTGTGGGGAGACGGG + Intronic
1182857949 22:33534702-33534724 TTCTGGGTTTGGGGAGAGGATGG + Intronic
1183387673 22:37524472-37524494 CTATGGGACTGGGGAGAGAAGGG + Intergenic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1184970901 22:48019169-48019191 AGGTGGGTTTGGGGTGAAAAGGG + Intergenic
1185272152 22:49934644-49934666 CTGGGGGTCGGGGGGCAGAAGGG + Intergenic
1185323854 22:50216126-50216148 CTCTGGGTTTCTAGGGAGAATGG + Intronic
949537359 3:5006273-5006295 CTCTGGGTGTGCGGGGAGCAGGG - Intergenic
949924821 3:9032725-9032747 CTGTGGTTTAGGGGGAAGACAGG + Exonic
949949163 3:9215221-9215243 CTTTGGGATTGGGTGGAAAAAGG - Intronic
949980594 3:9499888-9499910 ATGTGGGTTGGGGGCAAGAATGG - Exonic
950043419 3:9934258-9934280 CTGTGGGGATGGGTGGGGAAAGG - Intronic
950428740 3:12938824-12938846 CTGTGTGTGTTGGGGGCGAAGGG + Intronic
950715193 3:14842837-14842859 CTGTGTGTTGGGTGTGAGAATGG + Intronic
951190990 3:19771410-19771432 CTGTGGATCTGGGGGAAGATTGG - Intergenic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
951668118 3:25149643-25149665 CTGTGGGTATGGGAGGTGAGTGG - Intergenic
954222071 3:49161014-49161036 CTGTGGGGTGGGGTGGAGAGGGG - Intergenic
954880220 3:53830838-53830860 CTGTGGGGGTGGGGGGCGAGGGG - Intronic
955822281 3:62908780-62908802 TTGTGGGGTTGGGGGGGGATGGG + Intergenic
955908113 3:63829208-63829230 CTGTAGGTTTGGGGGGTATAGGG + Intronic
955920279 3:63947846-63947868 TTCTGGGTTTGAGGAGAGAAGGG + Intronic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956544111 3:70380687-70380709 TTGTGGGGTAGGGGGGAGAGGGG - Intergenic
957284143 3:78195572-78195594 TTGTGGGGTGGGGGGGAGAGGGG + Intergenic
958490978 3:94772843-94772865 CCAGGGGTTTGGGGGAAGAACGG + Intergenic
958644320 3:96850155-96850177 CTGTGGTTTGGAGTGGAGAAGGG + Intronic
960047509 3:113212067-113212089 CTGTTGGTTCGGGGAGAGGAGGG + Intronic
960203780 3:114870429-114870451 ATATGGGATTGGAGGGAGAATGG - Intronic
960456881 3:117883104-117883126 TTGTGGGGTTGGGGGGAGTGGGG + Intergenic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960942189 3:122942417-122942439 GTGTGGGGTTGGGGAGAGGATGG - Intronic
961012402 3:123445225-123445247 CAGTGGGGGTGGGGAGAGAAGGG + Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961628339 3:128279050-128279072 CTTTGAGTTGGGGAGGAGAATGG + Intronic
962036929 3:131661961-131661983 CTATGGGTTTGGGGGAATTATGG + Intronic
962428664 3:135298765-135298787 CTGTGGGTTGATGGGGAGATGGG + Intergenic
962429804 3:135308545-135308567 CTGTGTGTCTGGGATGAGAATGG - Intergenic
962920508 3:139946364-139946386 CTCTGGGTTTGGTGGTAGACAGG + Intronic
962927867 3:140011842-140011864 CAGTGGGTGTGGGGTGAGAGTGG + Intronic
963254940 3:143135546-143135568 CTGATATTTTGGGGGGAGAATGG - Intergenic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964975394 3:162613227-162613249 CTGTGAGTCTGAGAGGAGAATGG + Intergenic
965637473 3:170798273-170798295 CTGGGGGTTGAGAGGGAGAAGGG + Intronic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
967028818 3:185586983-185587005 CTGTGTGTTTGGGGCCAGAAGGG + Intronic
967251273 3:187541932-187541954 TTGTGGGGTTGGGGGAAGAGGGG - Intergenic
967388099 3:188929816-188929838 CTGTGAGTGTGGGGGTAGCACGG - Intergenic
968185378 3:196630108-196630130 CTGGGGGTTTGGGGGAAAATGGG - Intergenic
968960274 4:3739859-3739881 CTGTGGTTTCAGGGGGAGCATGG - Intergenic
969254036 4:5990524-5990546 CTGTGGCTTTGGGAGGAGGCGGG + Intergenic
969456622 4:7303873-7303895 CTGAGAGTGTGGGGAGAGAAAGG + Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971259490 4:25043373-25043395 TTGTGGGCTTTGGGGGAGAAGGG + Intergenic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
972434749 4:39022248-39022270 CTTTGGCTATGGGTGGAGAAAGG - Intronic
972668890 4:41195134-41195156 CTGTAGGTTTGGGAGTATAACGG - Intronic
972685216 4:41346014-41346036 CTCTGGGTATGTGGGGGGAAGGG - Intergenic
973774937 4:54233676-54233698 CTCTGGGTTTGGATTGAGAATGG + Intronic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
973835390 4:54804331-54804353 AAGTGGGTTTGGGGGGTGAATGG - Intergenic
974149261 4:57984803-57984825 CAGTGGGTTTAGAGGGAGTAGGG + Intergenic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975330603 4:73108224-73108246 TTGTGGGTTTGGGGTGGGCAAGG + Intronic
975923582 4:79422193-79422215 TTGTGGGGTAGGAGGGAGAATGG - Intergenic
975950525 4:79764512-79764534 CTCTGTGTTTGAGGGCAGAAGGG + Intergenic
976009618 4:80471593-80471615 CAGGGGGGTTGGGGGGAGCAGGG + Intronic
976195396 4:82527184-82527206 CTGTGTGTTTCCGGTGAGAATGG + Intronic
976300207 4:83509354-83509376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
977390099 4:96398000-96398022 TTGAGGGGTTGGGGGGTGAAGGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
978189734 4:105896831-105896853 CTTTGGGCCTGGGGGTAGAAAGG + Intronic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
981051039 4:140309805-140309827 CTGTGGGGTTTGGGGGAGACAGG - Intronic
981259729 4:142705444-142705466 GTGTGTGTTTGGGGTGGGAATGG - Intronic
982430589 4:155317713-155317735 ATGTGTGTTTGGGGAGAGAGGGG - Intergenic
983604082 4:169565793-169565815 CTGCGGGGTTGGGGGAAGAATGG + Intronic
983953426 4:173669478-173669500 GTGTGGGTTTTGGAGGAGGATGG + Intergenic
984715283 4:182918832-182918854 CGGTGGATTTGGGAGGAGGAGGG - Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
985898389 5:2764619-2764641 CTGCGAGTTTGGGGGCAGCACGG + Intergenic
986038473 5:3963249-3963271 CTTTGGATTTTGAGGGAGAAGGG + Intergenic
986178797 5:5374323-5374345 CTGTGGATGTGAGAGGAGAAAGG + Intergenic
986363260 5:7002674-7002696 CTATGTGCTTGTGGGGAGAAGGG + Intergenic
987455562 5:18141253-18141275 CAGTGGGGTAGGGAGGAGAATGG - Intergenic
988226260 5:28415001-28415023 CTAAGGGTTGGGGGGGAGGAAGG + Intergenic
988483500 5:31649015-31649037 CTCTGGGTTGGGGGGCAGGAGGG - Intronic
988536533 5:32073934-32073956 CTGTGGGCTTCCGGGGAGACTGG - Exonic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989107543 5:37877915-37877937 GTGTGGGGTGGGGTGGAGAAGGG + Intergenic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989322384 5:40151415-40151437 GTGTGGGTTTTGGGGGTGGAGGG - Intergenic
989702431 5:44286254-44286276 TTGTGGGGTGGGGGGGAGAGGGG - Intergenic
990442747 5:55862858-55862880 TTCTGGGTTTAGGGGGAAAAAGG + Intronic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
992231267 5:74666578-74666600 CTGTGACTTTGGGGGCAGCAGGG - Intronic
993691345 5:91004746-91004768 CTGGGGCTTCAGGGGGAGAATGG + Intronic
994914814 5:105961855-105961877 ATGTGAGTTGGGGGGGAGATGGG - Intergenic
995907197 5:117139646-117139668 CTGTGGATATGGGAGGAGAGAGG + Intergenic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996091990 5:119360517-119360539 ATGTGTATTTGGTGGGAGAAGGG - Intronic
997511500 5:134457910-134457932 CTCTGGCTTTGGGTGGAGAATGG + Intergenic
998605385 5:143628335-143628357 TTGTGGGGTTGGGGGGGGAGGGG + Intergenic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
999238317 5:150113203-150113225 CTGTGGCTTTGAGGGCAGAGAGG - Intronic
999320852 5:150614282-150614304 CTGTGTGTGTGGTGGGGGAAGGG - Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002131416 5:177084336-177084358 ATGTGGTTGTGGGGGGAGACAGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004180827 6:13379186-13379208 TTGTGTGTTTGGGGGAGGAAAGG + Intronic
1004418202 6:15444555-15444577 GTGTGTGTCTGGGGGGCGAATGG + Intronic
1005025595 6:21460244-21460266 GTGTGGGTTTGGGTTGAGAAAGG + Intergenic
1005720931 6:28601516-28601538 CTCTTGTTTTGAGGGGAGAAGGG + Intronic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1006073853 6:31516533-31516555 CCATGGGTTGGGAGGGAGAATGG + Intergenic
1006645628 6:35512497-35512519 CTGGAGATCTGGGGGGAGAAAGG - Intronic
1006648883 6:35534850-35534872 CTGGGGGTTTGGGGGAAGAGGGG - Intergenic
1006837303 6:37006789-37006811 CTGTGGGTGTGAGGGAAGCAGGG + Intronic
1007791146 6:44309255-44309277 CTGTCAGTTTGGGGGCAGTAGGG - Intronic
1007838336 6:44695262-44695284 TTGTGGGGTGGGGGGGAGAGGGG - Intergenic
1007975696 6:46098978-46099000 CTGCGGGGGTGGGGGTAGAAGGG + Intergenic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008532537 6:52477099-52477121 CGGGGGGTTGGGGGGGACAATGG - Intronic
1008847662 6:55987366-55987388 CTGGGGGTTTGGGGGAAGTGGGG - Intergenic
1008875240 6:56318909-56318931 GTGTGTGTTTGGGGGGAGGTGGG - Intronic
1009026502 6:58006766-58006788 GTGTGGGTTTGGGAGTGGAATGG + Intergenic
1009202051 6:60758239-60758261 GTGTGGGTTTGGGAGTGGAATGG + Intergenic
1009944168 6:70323555-70323577 TTGTGGGGTTGGGGGGAGAGGGG + Intergenic
1010136517 6:72560669-72560691 TGGTGGGTTTGGGGAGAGAGGGG + Intergenic
1010444957 6:75939344-75939366 TTGTGGGGTGGGGGGGAGCAGGG - Intronic
1010447780 6:75967342-75967364 TGGTGGGTTGGGGGTGAGAAGGG + Intronic
1010637918 6:78283328-78283350 CTGTGGGTTTTTGGGGACAGGGG + Intergenic
1010928535 6:81772754-81772776 ATTTGGGTTTAGGGGGAAAATGG + Intergenic
1011009035 6:82682821-82682843 CTCTGGATTTTGGGGCAGAAGGG + Intergenic
1011394483 6:86891822-86891844 CTGTGGGTTTTGGGGGATAGGGG - Intergenic
1012266197 6:97146341-97146363 CTGTGTTTTTGGTGGGGGAAAGG - Exonic
1013624061 6:111919827-111919849 CAGCTGGTTTGGGGGAAGAAAGG - Intergenic
1013740514 6:113278450-113278472 CTATGGCTTTGGAAGGAGAAGGG + Intergenic
1014098342 6:117483121-117483143 CTCTGGTTTTGGGGGAAGGAAGG - Intronic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1016438204 6:144059200-144059222 CTGTGGCTTTGGGGAGTGCAAGG - Intronic
1016869586 6:148803668-148803690 CTGAGGGTTTGGGGGCAGTGTGG - Intronic
1017869098 6:158471071-158471093 ATGTGGGTTTGAGGGCAGTAGGG + Intronic
1018091050 6:160347636-160347658 CAGGAGGTTTGGGGTGAGAAGGG - Intergenic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018832403 6:167453741-167453763 CTGTGGCTTTCAGGGGAGATTGG + Intergenic
1018896658 6:168023781-168023803 ATGTTGGTTAGGGGAGAGAAAGG + Intronic
1019331912 7:464456-464478 CTGTGGGGTTGTGGGGGGCAGGG + Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1021124562 7:16836469-16836491 CCCTGAGTTTTGGGGGAGAATGG - Intergenic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022163793 7:27738378-27738400 TTCTGGGTTTTGGGGGAGTAGGG - Intergenic
1022542137 7:31147063-31147085 ATGTGGGGTGGCGGGGAGAATGG + Intergenic
1023477176 7:40593283-40593305 GTGTGGGTTTGGGGAGGCAACGG - Intronic
1023637628 7:42228263-42228285 CTGGGTGTCTGGGGGCAGAAGGG + Intronic
1023908261 7:44537012-44537034 CTGTGGGTCTGGGGTGGGAGGGG - Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1025194699 7:56923784-56923806 CTTTGGGTTTGGGGCCAGACAGG + Intergenic
1025677253 7:63653159-63653181 CTTTGGGTTTGGGGCCAGACAGG - Intergenic
1026092124 7:67308997-67309019 CTGTGAGTTTGTGGGGACATTGG + Intergenic
1027432200 7:78125838-78125860 CTTTGGGGTTGGGGAGAAAATGG + Intronic
1027498453 7:78917887-78917909 GTGTGGGGTAAGGGGGAGAATGG + Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1028009334 7:85620640-85620662 CTGGGGCTTTGGGGGGTGGAGGG + Intergenic
1028239278 7:88399432-88399454 CTGTGGGTTTGAGGGGCTGAGGG + Intergenic
1028327758 7:89547885-89547907 CTTTGGGTTTTGTTGGAGAAAGG + Intergenic
1029188471 7:98755703-98755725 ATGTGGGTTTGGGGTTGGAAGGG - Intergenic
1029303665 7:99603216-99603238 CTGTGGGTTTAGGTGGGGAGAGG - Intronic
1030947261 7:115738969-115738991 TTGTGGGGTGGGGGGGAGAGGGG + Intergenic
1032401303 7:131626226-131626248 AGGTGGGTTTGGTGGGAGCAGGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033226474 7:139566949-139566971 CACTGGGTTTGAGGGAAGAACGG + Exonic
1033237099 7:139646768-139646790 CTGGGGCTTTGGGTGGAGAAGGG + Intronic
1033278895 7:139992027-139992049 CTGGGCGTTGGGGGAGAGAAAGG - Intronic
1034483646 7:151342113-151342135 GTATCGGTTTGGGGAGAGAAAGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1035317092 7:158003047-158003069 CTGTGGATTTTGGGGGACACAGG - Intronic
1035477085 7:159151446-159151468 CTGAGGGTTGGGGGTGAGCAGGG - Intergenic
1036222078 8:6929498-6929520 GTGTGGGTGTGAGAGGAGAAAGG + Intergenic
1037397327 8:18456876-18456898 ATGTGTGTTTAGTGGGAGAAAGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037736499 8:21571175-21571197 CTGTAGGTTTTGGAGGAGAGTGG - Intergenic
1037824971 8:22155611-22155633 CAGTGAATTTGGGAGGAGAAGGG - Intronic
1038790959 8:30667920-30667942 CTGTGGGCTCTGGGGGATAAGGG - Intergenic
1039352234 8:36775422-36775444 TTGTGGGGTTGGGGGGAGTGGGG + Intergenic
1040529645 8:48256154-48256176 TTGTGGGTTTAGGGGAATAAGGG + Intergenic
1041207202 8:55511173-55511195 CTGTGTGTCTGGGGTGGGAAGGG - Intronic
1041296506 8:56362588-56362610 CTGTGGGTTTGTGACCAGAAGGG + Intergenic
1041555734 8:59153030-59153052 CTAGGGGTTGGAGGGGAGAAAGG - Intergenic
1042556206 8:70035354-70035376 CTGTTGGTTTTGGGGGCGGAGGG - Intergenic
1042598399 8:70473573-70473595 GTCTGGGGCTGGGGGGAGAAGGG - Intergenic
1042917616 8:73890715-73890737 CTGGGGGTTGGTGGGGAGAGTGG + Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1043387899 8:79766534-79766556 CTTTGGGGGTGGGGAGAGAACGG - Intronic
1043569003 8:81580689-81580711 CTTTGCCTTTGGGGGGACAATGG - Intergenic
1044270769 8:90240448-90240470 TTGTGGGGTGGGGGGGAGAGGGG + Intergenic
1044692313 8:94893850-94893872 GGGTGGGTTTGGGGGAAAAATGG - Intronic
1044920553 8:97165458-97165480 CTTTGGGGTTGGGAGGAGAATGG - Intergenic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1046530772 8:115442595-115442617 GTGTGTGTTTGGGGGAAGGAAGG + Intronic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047210332 8:122835354-122835376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
1047584246 8:126252197-126252219 GTGTGGGGTTGGGGTGGGAATGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048230687 8:132637704-132637726 CTGTGTGTTTTGGATGAGAAAGG + Intronic
1048570783 8:135653987-135654009 CTGTGGGTGTGTGGGGGTAAAGG - Intronic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1048717148 8:137282805-137282827 CTGAGGGTTTGAAGGGGGAAGGG - Intergenic
1049255847 8:141613443-141613465 CTGTGGGTCAGGGGAGGGAAAGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049803252 8:144527780-144527802 CTGCGGGTCTGGGGGATGAAGGG + Exonic
1049934007 9:483254-483276 CTGTGGATTAGAGGGGAGTATGG + Intronic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050599696 9:7238000-7238022 TTGTGGCTTTGTGGGGAGGAGGG + Intergenic
1050609712 9:7339053-7339075 CTGTGTGTTTGGGTGCAAAATGG - Intergenic
1050847703 9:10243812-10243834 CTTTAGGTTTGGGAGGATAAAGG - Intronic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1051506224 9:17830538-17830560 CTGAGATTTTGGAGGGAGAAAGG - Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1052470760 9:28893113-28893135 CTGTTGGATTGGGTAGAGAATGG - Intergenic
1052533695 9:29721605-29721627 TTGTGGGGTCGGGGGGAGCAGGG - Intergenic
1052816691 9:33107421-33107443 GTGTGGGGGTGGGGGGAGAGGGG - Intronic
1052955420 9:34250066-34250088 CTGTGGGTTTGTGAGGACACGGG + Intronic
1053104567 9:35398836-35398858 GTGTGTGTTTGGGGAGGGAAAGG + Intronic
1053163422 9:35829065-35829087 CTCTGTGCTTGGGGTGAGAAAGG + Intronic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1055638262 9:78298161-78298183 CGGTGGGTTTGGCGGGGGAGGGG - Intronic
1056044265 9:82700800-82700822 CTATGAGTTTAGGGGGAAAAAGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056374569 9:85994316-85994338 GTGAGGGTTTGTGGGGAGGAGGG - Intronic
1057702677 9:97375220-97375242 CTGGGGTTCTGGGGGGGGAAGGG - Intronic
1058275649 9:103038190-103038212 CTGTGGGTGTTGGGGGACAGGGG - Intergenic
1058453467 9:105117712-105117734 GTGAGGGTTTGGGGAGAGAGGGG + Intergenic
1058842250 9:108921256-108921278 CTGTGGGGTGGGGTGGGGAAGGG - Intronic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058906734 9:109488065-109488087 GTGTGGGGTCGGGGGGAGGAGGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059421287 9:114194097-114194119 CTGTGGGTTTGGCTGCTGAAAGG + Intronic
1059426189 9:114222373-114222395 CTGGGGGTTTGATGAGAGAAGGG - Intronic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1059713768 9:116894190-116894212 CTCTGGGTTCAGGGGCAGAAAGG - Intronic
1059769213 9:117412003-117412025 CTGGGGGTTGGGGGGGGGAGGGG - Intronic
1059929698 9:119248900-119248922 CTTTGGGTTTGGGATGGGAAGGG - Intronic
1060370605 9:123066672-123066694 CTGAAGCTTTGGGGGTAGAAGGG - Intronic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1061256869 9:129458723-129458745 CTGTGGGGGTAGGGGGCGAAAGG - Intergenic
1061347390 9:130037660-130037682 GTGTGTATTTGGGGGCAGAAAGG + Intronic
1062021713 9:134322664-134322686 CTTTGGGTTTGGGGTGTGCAGGG + Intronic
1062262916 9:135671774-135671796 CTGGGGGTTTGGGGTGGGACGGG + Intergenic
1062601687 9:137321187-137321209 CTGAGGCTGTGGGGGCAGAAGGG + Intronic
1186139508 X:6556198-6556220 GTGTGGGTTCGGGGGGAGACTGG - Intergenic
1186529220 X:10278513-10278535 TTGTGGGTGGCGGGGGAGAAAGG + Intergenic
1187019952 X:15370742-15370764 CAGTGGGTTTGGGGCAAGACAGG + Intronic
1187441828 X:19327823-19327845 CTGTGGGGTTGGGTTGAGAAAGG - Intergenic
1187461073 X:19487122-19487144 CTGGGGGTGGGGGGGGGGAAGGG + Intronic
1187625059 X:21102018-21102040 GGGTGGGTTTGGGGGGAGTGGGG + Intergenic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1188883490 X:35519503-35519525 CTATATGTTTGTGGGGAGAAGGG + Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1190327975 X:49218428-49218450 CTGTGGGTTTGGGTGGGGTGGGG + Intronic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190366045 X:49695760-49695782 GTGTGGCTTTTGAGGGAGAAGGG - Intronic
1190409193 X:50117749-50117771 CTGTAGGGTTGGGGAGATAAAGG + Intergenic
1190708135 X:53047976-53047998 CTGGGGGGTTGGGGTGGGAAAGG - Intergenic
1191927061 X:66324746-66324768 GTGTGGGTGTGGGTGGAGATGGG + Intergenic
1192037956 X:67586254-67586276 TTGTGTGTTTGGGGGAAGGAGGG - Intronic
1192826677 X:74704495-74704517 CTGTGTGTTTGTGGGGGAAATGG - Intergenic
1193054923 X:77139718-77139740 CTGTGGCATGGGGAGGAGAATGG - Intergenic
1196128432 X:112125420-112125442 CTGCGGTTTTGTGGGGAGAGTGG - Intergenic
1196917498 X:120552594-120552616 CTGTGGATTTTGGAGGGGAAGGG - Intronic
1197571271 X:128153635-128153657 CTGTGCGGTTGGGGGGAGAGGGG + Intergenic
1199164933 X:144660573-144660595 CTGTGAGGTTGTGGGGAAAAGGG - Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1199912994 X:152307925-152307947 CAGAGGGTTTGGCGTGAGAATGG + Intronic
1200035016 X:153321309-153321331 CTCTGGCTTTCGGGGGAGGAAGG - Intergenic
1201229800 Y:11853145-11853167 CTGTGGCTGAGTGGGGAGAATGG + Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic